Germline Allele-Specific Expression of DAPK1 in Chronic Lymphocytic Leukemia

We previously reported a rare germline variant (c.1-6531) that resulted in allele–specific expression (ASE) of death-associated protein kinase 1 (DAPK1) and predisposition to chronic lymphocytic leukemia (CLL). We investigated a cohort of CLL patients lacking this mutation for the presence of ASE of DAPK1. We developed a novel strategy that combines single-nucleotide primer extension (SNuPE) with MALDI-TOF mass spectrometry, and detected germline DAPK1 ASE in 17 out of 120 (14.2%) CLL patients associated with a trend towards younger age at diagnosis. ASE was absent in 63 healthy controls. Germline cells of CLL patients with ASE showed increased levels of DNA methylation in the promoter region, however, neither genetic nor further epigenetic aberrations could be identified in the DAPK1 5′ upstream regulatory region, within distinct exons or in the 3′-UTR. We identified B-lymphoid malignancy related cell line models harboring allelic imbalance and found that allele-specific methylation in DAPK1 is associated with ASE. Our data indicate that ASE at the DAPK1 gene locus is a recurrent event, mediated by epigenetic mechanisms and potentially predisposing to CLL.     

Ubiquitin-Like Protein from Human Placental Extract Exhibits Collagenase Activity

An aqueous extract of human placenta exhibits strong gelatinase/collagenase activity in zymography. 2-D gel electrophoresis of the extract with gelatin zymography in the second dimension displayed a single spot, identified as ubiquitin-like component upon MALDI/TOF MS/MS analysis. Immunoblot indicated presence of ubiquitin and absence of collagenase in the extract. Collagenase activity of the ubiquitin-like component was confirmed from the change in solubility of collagen in aqueous buffer, degradation of collagen by size-exclusion HPLC and atomic force microscopy. Quantification with DQ-gelatin showed that the extract contains 0.04 U/ml of collagenase activity that was inhibited up to 95% by ubiquitin antibody. Ubiquitin from bovine erythrocytes demonstrated mild collagenase activity. Bioinformatics studies suggest that placental ubiquitin and collagenase follow structurally divergent evolution. This thermostable intrinsic collagenase activity of placental extract might have wide physiological relevance in degrading and remodeling collagen as it is used as a drug for wound healing and pelvic inflammatory diseases.     

Phytochemicals modulate cancer aggressiveness: A review depicting the anticancer efficacy of dietary polyphenols and their combinations

Cancer is referred to as the “Emperor of all maladies” accounting for the second-highest mortality rates worldwide. Major factors associated with cancer lethality are uncontrolled proliferation, metastasis, and frequent recurrence. The conventional therapeutic drugs used in cancer therapy have been associated with numerous damaging side-effects that call for the use of alternative therapeutic options. The natural plant compounds (NPCs) have been found to be effective against diverse groups of diseases including cancer. Among the different types, the polyphenolic phytochemicals like curcumin, (−)epigallocatechin-3-gallate, Resveratrol, and nimbolide which are predominant parts of daily dietary intake have proved their potency in reducing the aggressive properties of cancer. Here, we have highlighted the mechanisms through which these NPCs influence growth, metastatic potential, and the drug-resistant behavior of different cancer types. Moreover, we have also emphasized on their function as modulators of the immune system as well as the metabolic properties of the tumor. The role of these phytochemicals in reducing cancer progression has been highlighted when administered unaided or in combination with similar group of compounds. Moreover, their ability to enhance the drug-sensitivity of cancer cells which accounts for their use in combination with conventional chemotherapeutics has also been discussed in this article. Therefore, co-administration of these phytochemicals with chemically similar group members or with conventional chemotherapeutics may prove to be an effective treatment strategy for cancer.     

A benign approach to the preparation of freshwater bryozoan statoblasts for scanning electron microscopy (SEM) imaging

Abstract

Several different species of freshwater Bryozoa, belonging to the genera Plumatella, Rumarcanella and Fredericella, were detected within the Northern Mallee Pipeline (NMP) system in Victoria, Australia, that required definitive identification. These organisms produce asexual buds called statoblasts, with valves composed of sclerotised chitin that bear minute micro-ornamentations of considerable taxonomical significance. Imaging and analysis of these distinctive micro-ornamentations using scanning electron microscopy (SEM) is often employed for species identification. Meticulous preparation of statoblast samples is therefore required that necessitates the removal of adhering debris, dehydration and drying—whilst mitigating specimen damage and distortion. This technical note describes an approach whereby each of these three steps have been individually designed to be as benign as possible, using mild detergent/sonication to remove debris, a gradual and gentle dehydration procedure using ethanol, and critical point drying. For the overall process, these methods are chosen to optimise control and to minimise the use of harsh and hazardous chemicals.     

Quantum Chemical Studies of Structures and Binding in Noncanonical RNA Base pairs: The Trans Watson-Crick:Watson-Crick Family

Abstract

The trans Watson-Crick/Watson-Crick family of base pairs represent a geometric class that play important structural and possible functional roles in the ribosome, tRNA, and other functional RNA molecules. They nucleate base triplets and quartets, participate as loop closing terminal base pairs in hair pin motifs and are also responsible for several tertiary interactions that enable sequentially distant regions to interact with each other in RNA molecules. Eleven representative examples spanning nine systems belonging to this geometric family of RNA base pairs, having widely different occurrence statistics in the PDB database, were studied at the HF/6–31G (d, p) level using Morokuma decomposition, Atoms in Molecules as well as Natural Bond Orbital methods in the optimized gas phase geometries and in their crystal structure geometries, respectively. The BSSE and deformation energy corrected interaction energy values for the optimized geometries are compared with the corresponding values in the crystal geometries of the base pairs. For non protonated base pairs in their optimized geometry, these values ranged from ?8.19 kcal/mol to ?21.84 kcal/mol and compared favorably with those of canonical base pairs. The interaction energies of these base pairs, in their respective crystal geometries, were, however, lesser to varying extents and in one case, that of A:A W:W trans, it was actually found to be positive. The variation in RMSD between the two geometries was also large and ranged from 0.32–2.19 Å. Our analysis shows that the hydrogen bonding characteristics and interaction energies obtained, correlated with the nature and type of hydrogen bonds between base pairs; but the occurrence frequencies, interaction energies, and geometric variabilities were conspicuous by the absence of any apparent correlation. Instead, the nature of local interaction energy hyperspace of different base pairs as inferred from the degree of their respective geometric variability could be correlated with the identities of free and bound hydrogen bond donor/acceptor groups present in interacting bases in conjunction with their tertiary and neighboring group interaction potentials in the global context. It also suggests that the concept of isostericity alone may not always determine covariation potentials for base pairs, particularly for those which may be important for RNA dynamics. These considerations are more important than the absolute values of the interaction energies in their respective optimized geometries in rationalizing their occurrences in functional RNAs. They highlight the importance of revising some of the existing DNA based structure analysis approaches and may have significant implications for RNA structure and dynamics, especially in the context of structure prediction algorithms.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Ecdysteroid Stimulated Protein Synthesis in the Male Accessory Reproductive Glands of Spodoptera litura

Summary

20-hydroxyecdysone stimulates protein synthesis in the male accessory reproductive glands of pharate adults of Spodoptera litura both in vivo and in vitro. Juvenile hormone-I has no synergistic effect when given in conjunction with ecdysone in vivo but it inhibits ecdysone-stimulated protein synthesis in vitro.     

Assessment of Soluble and Biomass K in Culture Medium Is a Reliable Tool for Estimation of K Releasing Efficiency of Bacteria

Abstract

Assessing the amount of released K from minerals in bacterial liquid culture is the main process for screening and isolation of efficient potassium releasing bacteria (KRB). This study was aimed to determine the amount of released K in solution phase or supernatant (SK) as well as microbial biomass K (MBK). Therefore, 20 different bacterial isolates belonging to the 10 bacterial genera (Beijerinckia, Klebsiella, Azotobacter, Pseudomonas, Agrobacterium, Rhizobium, Sphingomonas, Citrobacter, Microbacterium, and Achromobacter) were individually used to inoculate Aleksandrov medium in presence of biotite or muscovite. Our results from in-vitro experiments revealed that the MBK (K in pellet) is more important than in SK. Although some genera such as Azotobacter and Citrobacter released more SK (16?mg/l from biotite and 12.77?mg/l from muscovite, respectively), the Klebsiella isolates with the highest MBK could release an average of 90?mg/l total K. This study indicated that the assimilated K in microbial cells is the main part of K dissolution from minerals. Due to the fast turnover of nutrients in bacterial biomass, it can be concluded that both SK and MBK could be available for plants. It seems that the finding of this research should be considered in the isolation of KRB.

Highlights

• This study reports, assessment of soluble and biomass K in the culture medium is a reliable tool for estimation of K releasing efficiency of bacteria

• Our results from in vitro experiments revealed that the assimilated K in microbial cells is the main part of K dissolved from minerals.

• Although some genera such as Azotobacter released more K in solution phase, the Klebsiella isolates with the highest biomass K could release more total K