Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Ecdysteroid Stimulated Protein Synthesis in the Male Accessory Reproductive Glands of Spodoptera litura

Summary

20-hydroxyecdysone stimulates protein synthesis in the male accessory reproductive glands of pharate adults of Spodoptera litura both in vivo and in vitro. Juvenile hormone-I has no synergistic effect when given in conjunction with ecdysone in vivo but it inhibits ecdysone-stimulated protein synthesis in vitro.     

Assessment of Soluble and Biomass K in Culture Medium Is a Reliable Tool for Estimation of K Releasing Efficiency of Bacteria

Abstract

Assessing the amount of released K from minerals in bacterial liquid culture is the main process for screening and isolation of efficient potassium releasing bacteria (KRB). This study was aimed to determine the amount of released K in solution phase or supernatant (SK) as well as microbial biomass K (MBK). Therefore, 20 different bacterial isolates belonging to the 10 bacterial genera (Beijerinckia, Klebsiella, Azotobacter, Pseudomonas, Agrobacterium, Rhizobium, Sphingomonas, Citrobacter, Microbacterium, and Achromobacter) were individually used to inoculate Aleksandrov medium in presence of biotite or muscovite. Our results from in-vitro experiments revealed that the MBK (K in pellet) is more important than in SK. Although some genera such as Azotobacter and Citrobacter released more SK (16?mg/l from biotite and 12.77?mg/l from muscovite, respectively), the Klebsiella isolates with the highest MBK could release an average of 90?mg/l total K. This study indicated that the assimilated K in microbial cells is the main part of K dissolution from minerals. Due to the fast turnover of nutrients in bacterial biomass, it can be concluded that both SK and MBK could be available for plants. It seems that the finding of this research should be considered in the isolation of KRB.

Highlights

• This study reports, assessment of soluble and biomass K in the culture medium is a reliable tool for estimation of K releasing efficiency of bacteria

• Our results from in vitro experiments revealed that the assimilated K in microbial cells is the main part of K dissolved from minerals.

• Although some genera such as Azotobacter released more K in solution phase, the Klebsiella isolates with the highest biomass K could release more total K

     

Purification of clinical-grade disulfide stabilized antibody fragment variable—Pseudomonas exotoxin conjugate (dsFv-PE38) expressed in Escherichia coli

Immunotoxins are rationally designed cancer targeting and killing agents. Disulfide stabilized antibody Fv portion—toxin conjugates (dsFv-toxin) are third generation immunotoxins containing only the antibody fragment variable portions and a toxin fused to the V_H or V_L. Pseudomonas exotoxin fragment (PE-38) is a commonly used toxin in immunotoxin clinical trials. dsFv-toxin purification was previously published, but the recovery was not satisfactory. This report describes the development of a cGMP production process of the dsFv-toxin that incorporated a novel purification method. The method has been successfully applied to the clinical manufacturing of two dsFv-PE38 immunotoxins, MR1-1 targeting EGFRvIII and HA22 targeting CD22. The two subunits, V_L and V_H PE-38 were expressed separately in Escherichia coli using recombinant technology. Following cell lysis, inclusion bodies were isolated from the biomass harvested from fermentation in animal source component-free media. The dsFv-toxin was formed after denaturation and refolding, and subsequently purified to homogeneity through ammonium sulfate precipitation, hydrophobic interaction and ion-exchange chromatography steps. It was shown, in a direct comparison experiment using MR1-1 as model protein, that the recovery from the new purification method was improved three times over that from previously published method. The improved recovery was also demonstrated during the clinical production of two dsFv-PE38 immunotoxins—MR1-1 and HA22.     

Structure modeling and antidiabetic activity of a seed protein of Momordica charantia in non-obese diabetic (NOD) mice

Momordica charantia is a well known medicinal plant used in the traditional medicinal system for the treatment of various diseases including diabetes mellitus. Recently, a novel protein termed as ADMc1 from the seed extract of M. charantia has been identified and isolated showing significant antihyperglycemic activity in type 1 diabetic rats in which diabetes was induced. However, the structure of this protein has not yet been analyzed. Homology modeling approach was used to generate a high quality protein 3D structure for the amino acid sequence of the ADMc1 protein in this study. The comparative assessment of secondary structures revealed ADMc1 as an all-alpha helix protein with random coils. Tertiary structure predicted on the template structure of Napin of B. Napus (PDB ID: 1SM7) with which the ADMc1 showed significant sequence similarity, was validated using protein structure validation tools like PROCHECK, WHAT_CHECK, VERIFY3D and ProSA. Arrangement of disulfide bridges formed by cysteine residues were predicted by the Dianna 1.1 server. The presence of multiple disulfide bond confers the stable nature of the ADMc1 protein. Further, the biological activity of the ADMc1 was assessed in non-obese diabetic (NOD) mice which are spontaneous model of type 1 diabetes. Significant reduction in the blood glucose levels of NOD mice was observed up to 8 h post administration of the rADMc1 protein. Overall, the structural characterizations with antihyperglycemic activity of this seed protein of Momordica charantia demonstrate its potential as an antidiabetic agent.     

Examination of Duct Physiology in the Human Mammary Gland

BackgroundThe human breast comprise several ductal systems, or lobes, which contain a small amount of fluid containing cells, hormones, proteins and metabolites. The complex physiology of these ducts is likely a contributing factor to the development of breast cancer, especially given that the vast majority of breast cancers begin in a single lobular unit.MethodsWe examined the levels of total protein, progesterone, estradiol, estrone sulfate, dehydroepiandrosterone sulfate, and macrophages in ductal fluid samples obtained from 3 ducts each in 78 women, sampled twice over a 6 month period. Samples were processed for both cytological and molecular analysis. Intraclass correlation coefficients and mixed models were utilized to identify significant data.ResultsWe found that the levels of these ductal fluid components were generally uncorrelated among ducts within a single breast and over time, suggesting that each lobe within the breast has a distinct physiology. However, we also found that estradiol was more correlated in women who were nulliparous or produced nipple aspirate fluid.ConclusionsOur results provide evidence that the microenvironment of any given lobular unit is unique to that individual unit, findings that may provide clues about the initiation and development of ductal carcinomas.     

Change of antioxidant enzymes activity of hazel (Corylus avellana L.) cells by AgNPs

Elicitation effect of silver nano particles (AgNPs) and triggering of defence system by production of hydrogen peroxide (H₂O₂) as a signaling molecule in the regulation of the activity of stress-related enzymes and production of Taxol was evaluated in suspension- cultured hazel cells (Corylus avellana L.). The cells were treated with different concentrations of AgNPs (0, 2.5, 5, and 10 ppm), in their logarithmic growth phase (d7) and were harvested after 1 week. Treatment of hazel cells with AgNPs decreased the viability of the cells. Also the results showed that while the activity of certain radical scavenging enzymes in particular of catalase and peroxidase increased by 2.5 and 5 ppm AgNPs, the activity of superoxide dismutase decreased in these treatments. The highest activity of ascorbate peroxidase was observed in 10 ppm AgNPs treatments. This treatment also showed the highest contents of H₂O₂ and phenolic compounds, as well as the highest activity of phenylalanine ammonialyase. According to the results, 5 ppm AgNPs was the best concentration for elicitation of hazel cells to produce efficient amounts of H₂O₂ in order for stimulation of antioxidant defence system, production of Taxol at the highest capacity of the cells, meanwhile reserving their viability.