Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Diaryl naphthyl methanes a novel class of anti-implantation agents

Diaryl naphthyl methanes and the corresponding 1, 2, 3, 4- and 5, 6, 7, 8-tetrahydro naphthyl methane derivatives have been synthesized as novel estrogen receptor binding ligands. The secondary and tertiary amino alkoxy derivatives of diaryl naphthyl and tetrahydro naphthyl methane interact with the estrogen receptor to elicit promising estrogenic, antiestrogenic and implantation inhibition activities in rats. The most active compounds in this series are 7, 9 and 20, cent percent active in preventing implantation in rats at 2.5 mgkg(-1) dose.     

The Diagnostic Accuracy of Urine Lipoarabinomannan Test for Tuberculosis Screening in a South African Correctional Facility

Background

We evaluated the diagnostic accuracy of the urine lipoarabinomannan (LAM) antigen detection assay (Clearview TB-ELISA) to screen for tuberculosis in a South African correctional facility.

Methods

Between September 2009 and October 2010, male offenders were screened for tuberculosis (symptoms, chest radiograph, two spot sputum specimens for microscopy and culture), and urine tested for LAM. Sensitivity, specificity and predictive values of LAM were calculated using definite and probable tuberculosis combined as our gold standard.

Findings

33/871 (3.8%) participants (26% HIV-positive) had tuberculosis. Amongst HIV-positive vs. HIV-negative offenders the sensitivity and specificity of LAM was 7.1% vs. 0% and 98.5% vs. 99.8% respectively.

Conclusion

Urine LAM ELISA has inadequate sensitivity for TB screening in this population.     

Improved productivity of <Emphasis Type="Italic">β</Emphasis>-fructofuranosidase by a derepressed mutant of <Emphasis Type="Italic">Aspergillus niger</Emphasis> from conventional and non-conventional substrates

Summary Wild-type cultures of Aspergillus niger produced a basal level of β-fructofuranosidase on glucose of 1 IU l⁻¹ h⁻¹. In contrast, a catabolite-derepressed mutant strain of the same organism produced a markedly higher level (25 IU l⁻¹ h⁻¹) of this enzyme when grown on the same carbon source. Wheat bran induced both the wild type (252 IU l⁻¹ h⁻¹) and the mutant strain (516 IU l⁻¹ h⁻¹) to produce 252- to 516-fold higher levels of this enzyme than was observed with the wild-type grown on glucose and was the best carbon source. When corn steep liquor served as a nitrogen source, the wild-type organism showed a higher activity of enzyme on monosaccharides and disaccharides comparable to that produced by corncobs in the basal medium and that mutant was a potentially improved (> 2-fold) organism for the production of β-fructofuranosidase on all carbon sources. Enhanced substrate consumption and product formation kinetic parameters suggest that the mutant organism may be exploited for bulk production of this useful enzyme.     

HNF1B and endometrial cancer risk: results from the PAGE study

We examined the association between HNF1B variants identified in a recent genome-wide association study and endometrial cancer in two large case-control studies nested in prospective cohorts: the Multiethnic Cohort Study (MEC) and the Women's Health Initiative (WHI) as part of the Population Architecture using Genomics and Epidemiology (PAGE) study. A total of 1,357 incident cases of invasive endometrial cancer and 7,609 controls were included in the analysis (MEC: 426 cases/3,854 controls; WHI: 931 cases/3,755 controls). The majority of women in the WHI were European American, while the MEC included sizable numbers of African Americans, Japanese and Latinos. We estimated the odds ratios (ORs) per allele and 95% confidence intervals (CIs) of each SNP using unconditional logistic regression adjusting for age, body mass index, and four principal components of ancestry informative markers. The combined ORs were estimated using fixed effect models. Rs4430796 and rs7501939 were associated with endometrial cancer risk in MEC and WHI with no heterogeneity observed across racial/ethnic groups (P ≥ 0.21) or between studies (P ≥ 0.70). The OR(per allele) was 0.82 (95% CI: 0.75, 0.89; P = 5.63 × 10(-6)) for rs4430796 (G allele) and 0.79 (95% CI: 0.73, 0.87; P = 3.77 × 10(-7)) for rs7501939 (A allele). The associations with the risk of Type I and Type II tumors were similar (P ≥ 0.19). Adjustment for additional endometrial cancer risk factors such as parity, oral contraceptive use, menopausal hormone use, and smoking status had little effect on the results. In conclusion, HNF1B SNPs are associated with risk of endometrial cancer and that the associated relative risks are similar for Type I and Type II tumors.     

Proteomic profiling of high glucose primed monocytes identifies cyclophilin A as a potential secretory marker of inflammation in type 2 diabetes

Hyperglycemia is widely recognized to be a potent stimulator of monocyte activity, which is a crucial event in the pathogenesis of atherosclerosis. We analyzed the monocyte proteome for potential markers that would enhance the ability to screen for early inflammatory status in Type 2 diabetes mellitus (T2DM), using proteomic technologies. Monocytic cells (THP-1) were primed with high glucose (HG), their protein profiles were analyzed using 2DE and the downregulated differentially expressed spots were identified using MALDI TOF/MS. We selected five proteins that were secretory in function with the help of bioinformatic programs. A predominantly downregulated protein identified as cyclophilin A (sequence coverage 98%) was further validated by immunoblotting experiments. The cellular mRNA levels of cyclophilin A in various HG-primed cells were studied using qRT-PCR assays and it was observed to decrease in a dose-dependent manner. LC-ESI-MS was used to identify this protein in the conditioned media of HG-primed cells and confirmed by Western blotting as well as ELISA. Cyclophilin A was also detected in the plasma of patients with diabetes. We conclude that cyclophilin A is secreted by monocytes in response to HG. Given the paracrine and autocrine actions of cyclophilin A, the secreted immunophilin could be significant for progression of atherosclerosis in type 2 diabetes. Our study also provides evidence that analysis of monocyte secretome is a viable strategy for identifying candidate plasma markers in diabetes.     

Structural re-positioning,in silico molecular modelling,oxidative degradation,and biological screening of linagliptin as adenosine 3 receptor (ADORA3) modulators targeting hepatocellular carcinoma

Chemical entities with structural diversity were introduced as candidates targeting adenosine receptor with different clinical activities, containing 3,7-dihydro-1H-purine-2,6-dione, especially adenosine 3 receptors (ADORA3). Our initial approach started with pharmacophore screening of ADORA3 modulators; to choose linagliptin (LIN), approved anti-diabetic drug as Dipeptidyl peptidase-4 inhibitors, to be studied for its modulating effect towards ADORA3. This was followed by generation, purification, analytical method development, and structural elucidation of oxidative degraded product (DEG). Both of LIN and DEG showed inhibitory profile against hepatocellular carcinoma cell lines with induction of apoptosis at G2/M phase with increase in caspase-3 levels, accompanied by a downregulation in gene and protein expression levels of ADORA3 with a subsequent increase in cAMP. Quantitative in vitro assessment of LIN binding affinity against ADORA3 was also performed to exhibit inhibitory profile at Ki of 37.7?nM. In silico molecular modelling showing binding affinity of LIN and DEG towards ADORA3 was conducted.     

Increased Frequency and Compromised Function of T Regulatory Cells in Systemic Sclerosis (SSc) Is Related to a Diminished CD69 and TGFβ Expression

Background

Regulatory T cells (Tregs) are essential in the control of tolerance. Evidence implicates Tregs in human autoimmune conditions. Here we investigated their role in systemic sclerosis (SSc).

Methods/Principal Findings

Patients were subdivided as having limited cutaneous SSc (lcSSc, n = 20) or diffuse cutaneous SSc (dcSSc, n = 48). Further subdivision was made between early dcSSc (n = 24) and late dcSSc (n = 24) based upon the duration of disease. 26 controls were studied for comparison. CD3+ cells were isolated using FACS and subsequently studied for the expression of CD4, CD8, CD25, FoxP3, CD127, CD62L, GITR, CD69 using flow cytometry. T cell suppression assays were performed using sorted CD4CD25^highCD127^- and CD4CD25^lowCD127^high and CD3⁺ cells. Suppressive function was correlated with CD69 surface expression and TGFβ secretion/expression. The frequency of CD4⁺CD25⁺ and CD25^highFoxP3^highCD127^neg T cells was highly increased in all SSc subgroups. Although the expression of CD25 and GITR was comparable between groups, expression of CD62L and CD69 was dramatically lower in SSc patients, which correlated with a diminished suppressive function. Co-incubation of Tregs from healthy donors with plasma from SSc patients fully abrogated suppressive activity. Activation of Tregs from healthy donors or SSc patients with PHA significantly up regulated CD69 expression that could be inhibited by SSc plasma.

Conclusions/Significance

These results indicate that soluble factors in SSc plasma inhibit Treg function specifically that is associated with altered Treg CD69 and TGFβ expression. These data suggest that a defective Treg function may underlie the immune dysfunction in systemic sclerosis.