Met-enkephalin immunoreactivity in blood platelets

Picogram amounts (50–150 pg/mg protein) of immunoreactive met-enkephalin material (met-enkephalin in IR) were detected by radioimmunoassay in human, rat and rabbit platelets. Characterization of this material by thin-layer chromatography, gel filtration chromatography and high-pressure liquid chromatography indicated that it behaves identically with synthetic met-enkephalin. No high molecular weight met-enkephalin IR could be detected in the platelet extracts, even after trypsin hydrolysis, using two antisera which are able to recognize some of the putative met-enkephalin precursors present in the adrenal gland or striatum. $\text{In vitro}$, thrombin released platelet met-enkephalin in IR concomitantly with 5-hydroxytryptamine (5-HT), suggesting a common subcellular localization, i.e. the 5-HT storing organelles, for met-enkephalin IR and the amine. $\text{In vivo}$, platelet met-enkephalin IR in the Sprague-Dawley rat was affected neither by adrenalectomy nor by hypophysectomy. Thirteen- and 18-week-old spontaneous hypertensive rats (SHR) had lower platelet concentrations of met-enkephalin in IR than age matched normotensive Wistar-Kyoto rats.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Decreased sensitivity of human platelets to PGI2 during long-term intraarterial prostacyclin infusion in patients with peripheral vascular disease — A rebound phenomenon?

During successful treatment of peripheral vascular disease with synthetic prostacyclin no alteration in platelet function was reported (1).In 8 patients infused with synthetic prostacyclin continuously for 7 days intraarterially, the platelet function was monitored. Special attention was drawn to the platelet sensitivity in vitro for PGI₂, which is discussed as an important factor maintaining the hemostatic balance.In all the patients with peripheral vascular disease between 24 and 48 hours after the beginning of the infusion a sudden decrease in platelet sensitivity accompanied by an increase in platelet count could be seen.These dramatic alterations representing probably a rebound phenomenon occurring during long-term PGI₂-treatment might be an explanation for a non-beneficial effect of the treatment and in some cases a limiting factor for the continuation of the infusion itself. It is not clear, if this rebound phenomenon is due to a stimulation of an endogenous inhibitor, lowering the synthesis of a naturally occurring substance acting against this inhibitor or tachyphylaxia.     

Enhanced erythroid burst formation in mice after testosterone treatment

A single administration of testosterone propionate (TP) in ex-hypoxic polycythemic mice induces, at 24 hr after androgen, an amplification of the erythroid burst-forming unit (BFU-E or B) pool in marrow. This phenomenon is not associated with an amplification of the erythroid colony-forming unit (CFU-E or E) compartment and is followed by its depletion. In the other hand, the 36–49 hr rise of erythropoietin (Ep) levels in serum is followed by a 60-hr amplification of the E pool. It is suggested that the latter phenomenon is mediated by enhanced Ep production, whereas the early amplification of the B compartment may derive from a direct influence of TP at the stem cell level.     

Langzeittelemetrie der K?rpertemperatur mit synchroner Bestimmung des Energiestoffwechsels beim Blaunackenmausvogel (Urocolius macrourus) unter Normal- und Lethargiebedingungen (Torpor)

Ohne Zusammenfassung

---

Long-term telemetry of body temperature with synchronous measurement of metabolic rate in torpid and non-torpid Blue-naped Mousebirds (Urocolius macrourus)

     

Metabolism of naphthalene by the biphenyl-degrading bacterium Pseudomonas paucimobilis Q1

Pseudomonas paucimobilis Q1 originally isolated as biphenyl degrading organism (Furukawa et al. 1983), was shown to grow with naphthalene. After growth with biphenyl or naphthalene the strain synthesized the same enzyme for the ring cleavage of 2,3-dihydroxybiphenyl or 1,2-dihydroxynaphthalene. The enzyme, although characterized as 2,3-dihydroxybiphenyl dioxygenase (Taira et al. 1988), exhibited considerably higher relative activity with 1,2-dihydroxynaphthalene. These results demonstrate that this enzyme can function both in the naphthalene and biphenyl degradative pathway.Abbreviations DHBP dihydroxybiphenyl - DHBPDO 2,3-dihydroxybiphenyl dioxygenase - DHDHNDH 1,2-dihydroxy-1,2-dihydronaphthalene dehydrogenase - DHN 1,2-dihydroxynaphthalene - DHNDO 1,2-dihydroxynaphthalene dioxygenase - HBP cis-2-hydroxybenzalpyruvate - HOPDA 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate - PCB polychlorinated biphenyl - 2NS naphthalene-2-sulfonic acid     

Lysis of autologous human melanoma cells by in vitro allosensitized peripheral blood lymphocytes

Summary Peripheral blood lymphocytes (PBL) of melanoma patients were sensitized in vitro with lymphocytes of a single donor or with a pool of lymphocytes of 5–20 different donors. After 6–7 days, the cytotoxic activity of the sensitized PBL was tested against cultured autologous tumor cells and lymphocytes in a ⁵¹Cr-release assay. Tumor lysis was observed in 13 of 16 cases in which patients' PBL (Pt-PBL) were stimulated by a pool of allogeneic lymphocytes and in five out of seven cases when single sensitization was performed. In no case was lysis of autologous normal lymphocytes or blasts seen. Cultivation of Pt-PBL with irradiated autologous tumor cells never led to the induction of lymphocytes cytotoxic to melanoma cells. Lysability by pool-activated autologous Pt-PBL of fresh cryopreserved tumor cells was compared to that of short-term cultured tumor cells, and no significant differences were observed. Cold-target inhibition experiments indicated that the cytotoxicity of Pt-PBL was tumor-restricted since only autologous melanoma cells but not lymphocytes were able to inhibit the reaction. These results indicate that activation of Pt-PBL is necessary in order to elicit or amplify their antitumor activity.     

Fermentation of Bacillus thuringiensis for exotoxin production: Process analysis study

The exotoxin produced by certain serotypes of Bacillus thuringiensis was used as a means of microbiological control of the larval development of flies. The optimal batch cultivation conditions with respect to pH, temperature, aeration, agitation, and initial concentration of growth-limiting substrate were determined. A dynamic model describing the process was designed and fitted to the experimental data. The application of a method for estimating exotoxin and bacterial concentrations from on-line measurable quantities such as oxygen consumption and heat production is presented.     

Differentiation of 2-cell and 8-cell mouse embryos arrested by cytoskeletal inhibitors

Mouse embryos at the 2-cell stage were cultured in the presence of cytochalasin B (CB), cytochalasin D (CD), colchicine (COL) or colcemid (COM) for up to 72 h. Cleavage was arrested in the 2-cell and 8-cell embryos cultured in CB or CD but the blastomeres continued to differentiate, since chromosome replication occurred in the blastomeres at approximately the same time as control embryos underwent cleavage; an increase in the incorporation of [³H]uridine into RNA was also detected. Furthermore, the cleavage-arrested embryos acquired the necessary information to undergo morphogenesis; these embryos when explanted to fresh medium after 48 h culture in CB or CD underwent compaction within 15–60 min and started to cavitate to produce trophoblastic vesicles within 5–6 h at the same time as when the control embryos were undergoing compaction and beginning to form blastocoelic cavities. In contrast, the embryos arrested in the presence of COM or COL showed none of these differentiative, biochemical or morphogenetic changes. Hence, differentiation of blastomeres and morphogenesis is apparently coupled with nuclear divisions and the information does not reside within the blastomeres at the 2-cell or 8-cell stage. The trophoblastic vesicles produced after cleavage arrest subsequently gave rise to only trophoblast giant cells and no embryonic derivatives were detected.     

Synthesis of membrane glycoproteins in rat small-intestinal villus cells. Redistribution of l-[1,5,6-3H]-fucose-labelled membrane glycoproteins among Golgi, lateral basal and microvillus membranes in vivo

The biogenesis of plasmalemma glycoproteins of rat small-intestinal villus cells was studied by following the incorporation of l-[1,5,6-(3)H]fucose, given intraperitoneally with and without chase, into Golgi, lateral basal and microvillus membranes. Each membrane fraction showed distinct kinetics of incorporation of labelled fucose and was differently affected by the chase, which produced a much greater decrease in incorporation of label into Golgi and microvillus than into lateral basal membranes. The kinetic data suggest a redistribution of newly synthesized glycoproteins from the site of fucosylation, the Golgi complex, directly into both lateral basal and microvillus membranes. The observed biphasic pattern of label incorporation into the microvillus membrane fraction may be evidence for a second indirect route of incorporation. The selective effect of the chase suggests the presence of two different pools of radioactive fucose in the Golgi complex that differ in (1) their accessibility to dilution with non-radioactive fucose, and (2) their utilization for the biosynthesis of membrane glycoproteins subsequently destined for either the microvillus or the lateral basal parts of the plasmalemma. The radioactively labelled glycoproteins of the different membrane fractions were separated by sodium dodecyl sulphate/polyacrylamide-slab-gel electrophoresis and identified by fluorography. The patterns of labelled glycoproteins in Golgi and lateral basal membranes were identical at all times. At least 14 bands could be identified shortly after radioactive-fucose injection. Most seemed to disappear at later times, although one of them, which was never observed in microvillus membranes, increased in relative intensity. All but two of the labelled glycoproteins present in the microvillus membrane corresponded to those observed in Golgi and lateral basal membranes shortly after fucose injection. The patterns of labelled glycoproteins in all membrane fractions were little affected by the chase. These data support a flow concept for the insertion of most surface-membrane glycoproteins of the intestinal villus cells.