Reduced childhood mortality after standard measles vaccination at 4-8 months compared with 9-11 months of age.

OBJECTIVE--To evaluate the impact on mortality of standard Schwarz measles immunisation before 9 months of age. DESIGN--Children vaccinated in 1980-3 at 4-5, 6-8, and 9-11 months of age were followed to migration, death, or the age of 5 years. SETTING--One urban district and nine villages in two rural areas of Guinea-Bissau. SUBJECT--307 children vaccinated at 4-8 months and 256 at 9-11 months. MAIN OUTCOME MEASURES--Mortality from 9 months to 5 years of age for children immunised at 4-5, 6-8, and 9-11 months. RESULTS--Mortality was significantly lower in children vaccinated at 6-8 months than at 9-11 months (mortality ratio = 0.63, (95% confidence interval 0.41 to 0.97), p = 0.047). As vaccination was provided in semiannual or annual campaigns it is unlikely that age at vaccination reflected a selection bias. The trend was the same in all three study areas. Improved survival after early immunisation was not related to better protection against measles infection. With a Cox multivariate regression model to adjust for age, sex, season at risk, season at birth, measles infection, and region, children vaccinated at 4-8 months had a mortality ratio of 0.61 (0.40 to 0.92, p = 0.020) compared with children vaccinated at 9-11 months. Reimmunised children tended to have lower mortality than children who received only one vaccine (0.59 (0.28 to 1.27, p = 0.176)). CONCLUSION--Standard measles vaccination before 9 months is not associated with higher childhood mortality than is the currently recommended strategy of immunising from 9 months, and it may reduce mortality. This has implications for measles immunisation strategy in developing countries.     

Maximal oxygen uptake, maximal voluntary isometric contraction and physical activity in young Danish adults

In a randomly selected sample of 88 men and 115 women, aged 23–27 years from Denmark, maximal oxygen uptake ( O_2max), maximal voluntary isometric contraction (MVC) in four muscle groups and physical activity were studied. The O_2max was 48.0 ml · min^–1 kg^–1 and 39.6 ml · min^–1 · kg^–1 for the men and the women, respectively. The MVC was 10% lower than in a comparable group of Danes of the same age and height studied 35 years ago. Only in men was sports activity directly related to O_2max (ml · min^–1 · kg^–1; r=0.31, P<0.01). The MVC of the knee extensors was related to O_2max in the men (r=0.31, P<0.01), but there was no relationship between the other measurements of MVC and O_2max. In the women O_2max (ml · min^–1 · kg^–1) was only related to body size, i.e. body mass index, percentage body fat and body mass [(r= –0.47, –0.48 (both P<0.001) and –0.34. (P<0.01), respectively)]. There were differences in O_2max in the men, according to education and occupation. Blue collar workers and subjects attending vocational or trade schools in 1983 had lower O_2max and more of them were physically inactive. In the women differences were also found, but there was no clear pattern among the groups. More of the women participated regularly in sports activity, but more of the men were very active compared to the women.     

Automatic sequencing of mitochondrial tRNA genes in patients with mitochondrial encephalomyopathy

We have investigated nine children with infantile onset of mitochondrial myopathy and two adults with myoclonus epilepsy and ragged-red fibers (MERRF) and chronic progressive external ophthalmoplegia (CPEO), respectively. These patients lacked any of the previously known pathogenic tRNA mutations. Southern blot analysis of muscle mtDNA revealed no deletions. The tRNA genes of muscle mtDNA were sequenced. Restriction enxyme analysis of PCR fragments was performed to verify the presence of the mutations identified by automatic sequencing. Several tRNA mutations were found, but they were all homoplasmic. Furthermore, the mutations were either present in controls or did not change nucleotides conserved between species. This strongly suggests that none of the tRNA mutations identified in the 11 patients with mitochondrial encephalomyopathy was pathogenic. It can thus be concluded that mitochondrial tRNA mutations and mtDNA deletions probably are an infrequent cause of mitochondrial disorders in infants. Patients with MERRF and CPEO may lack both pathogenic point mutations of tRNA genes and deletions of mtDNA.     

Characterization of β-hydroxybutyrate transport in rat erythrocytes and thymocytes

A method was developed for study of β-hydroxybutyrate transport in erythrocytes and thymocytes. Critical to the method was a centrifugal separation of cells from medium which took advantage of β-hydroxybutyrate transport's temperature dependence and inhibition by phloretin and methylisobutylxanthine, all of which are demonstrated in this work. These properties suggested mediated transport, as did saturation kinetics and inhibition by several agents including pyruvate and α-cyanocinnamate. Most conclusive in this regard was a 2-fold preference for d- over l-β-hydroxybutyrate. Entry was not Na⁺ dependent. It was stimulated by substitution of SO₄^2? for most of the Cl^?. The equilibrium β-hydroxybutyrate space was much higher than the Cl^? space of thymocytes, suggesting that β-hydroxybutyrate entry is not associated with net inward negative current and is not coupled to outward Cl^? or inward K⁺ movement (assuming that K⁺ is at electrochemical equilibrium). Coupling to H⁺ entry or OH^? exit is compatible with the result. These findings are consistent with β-hydroxybutyrate entry by the carboxylate transport site which has been studied extensively with pyruvate and lactate as permeants. The Cl^?/HCO₃^? exchange carrier did not appear to contribute significantly to β-hydroxybutyrate transport.     

Excitation and inhibition of neurons in the trigeminal nucleus caudalis following periaqueductal gray stimulation

Electrical stimulation (3-4 shocks, 300 Hz, 30-150 microamperemeter) of the periaqueductal gray matter (CG) or dorsal raphé nucleus (DR) of decerebrate cats reduced or abolished the jaw-opening reflex response evoked by stimulation of either the tooth pulp or infraorbital nerve. In addition, CG or DR stimulation inhibited the response of 12 out of 16 trigeminal nucleus caudalis neurons to activation of their sensory afferent inputs. Ten other neurons recorded in the same sites, and often at the same time, but which did not respond to the sensory inputs utilized, were excited by identical stimuli to CG or DR. This excitatory response was blocked by intravenously administered naloxone (0.1-0.2 mg/kg). It is suggested that those neurons which are excited by CG and DR stimulation may be interneurons involved in pre- and post-synaptic inhibition of sensory transmission during stimulus-produced or narcotic analgesia.     

Microfilament bundles in cultured cells : Correlation with anchorage independence and tumorigenicity in nude mice

The distribution of actin microfilament bundles in cell lines 3T3B, CHO, HeLa and CLID extracted with 0.1% Triton X-100 was examined by indirect immunofluorescence using human actin antibodies and by electron microscopy of whole cells grown directly on support grids. Anchorage dependence as determined by growth in soft agar and tumorigenicity in nude mice was also investigated. Immunofluorescent staining showed that CHO and HeLa cells have normal numbers and distributions of actin microfilament bundles as compared with similarly spread control 3T3B cells. A significant fraction of the mouse CLID cells showed comparable numbers of microfilament bundles as 3T3B cells but their distribution was markedly different. In many cases the bundles radiated from a region close to the cell's centre or near its projections and usually penetrated the projections. The presence of diffuse staining in 4% of the cell population also indicated the existence in these cells of disorganized actin. Electron microscope studies of well spread regions of negatively-stained, Triton-extracted cells corroborated the observations made with the immunofluorescence technique. In 3T3B, CHO and CLID cells abundant microtubules were found, colinearly arranged with actin filaments in the thin cytoplasmic extensions. While CLID, CHO and HeLa cells showed the capacity to grow in soft agar, only CLID and HeLa cells produced tumours in athymic nude mice. The observations suggest that a reduction or disorganisation of the actin microfilament bundles may not in itself be essential at least for the non-virally transformed cells studied to show anchorage independence or to produce tumours in nude mice.     

Plasmids required for utilization of molecular hydrogen by Alcaligenes eutrophus

Alcaligenes eutrophus and three other hydrogen bacteria exposed to plasmid-curing agents generated autotrophic-minus mutants at high frequency. These mutants were blocked in the metabolism of H₂ as an energy source and had normal levels of enzymes involved in CO₂ fixation. The loss of hydrogenase activity in A. eutrophus was accompanied by the loss or alteration of a plasmid that had molecular weight of approximately 200×10⁶. Mobilization of this plasmid from wild-type A. eutrophus strains into cured hydrogenase-minus derivatives restored hydrogenase function. It is concluded that A. eutrophus contains a large plasmid required for hydrogen metabolism and thereby autotrophic growth.Abbreviations Aut autotrophic - Hup hydrogen uptake - NTG N-methyl-N-nitro-N-nitrosoguanidine - RuBP ribulose bisphosphate - RuMP ribulose monophosphate - Kan kanamycin - Nal nalidixic acid - Rif rifampicin - Tet tetracycline     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Omega chain methylated analogs of PGF2α and PGE2

Our previously published prostaglandin (PG) synthesis route, in which the ω-chain is added in the penultimate step, provides facile access to a wide variety of ω-chain variant PG analogs. Each series requires only the synthesis of the appropriate methylated acylphosphonate for the Emmons' condensation. The syntheses of analogs bearing the following methylation pattern are detailed: 15-Me; 17, 17-(Me)₂; 17, 17, 20-(Me)₃; 18, 18, 20-(Me)₃; 15, 18, 18, 20-(Me)₄; and 15-Ome-18, 18, 20-(Me)₃. The well-known 16, 16-dimethyl prostaglandins have also been prepared by this sequence. The synthesis of 16, 16-tetramethylene-PG analogs is also described.