Excitation and inhibition of neurons in the trigeminal nucleus caudalis following periaqueductal gray stimulation

Electrical stimulation (3-4 shocks, 300 Hz, 30-150 microamperemeter) of the periaqueductal gray matter (CG) or dorsal raphé nucleus (DR) of decerebrate cats reduced or abolished the jaw-opening reflex response evoked by stimulation of either the tooth pulp or infraorbital nerve. In addition, CG or DR stimulation inhibited the response of 12 out of 16 trigeminal nucleus caudalis neurons to activation of their sensory afferent inputs. Ten other neurons recorded in the same sites, and often at the same time, but which did not respond to the sensory inputs utilized, were excited by identical stimuli to CG or DR. This excitatory response was blocked by intravenously administered naloxone (0.1-0.2 mg/kg). It is suggested that those neurons which are excited by CG and DR stimulation may be interneurons involved in pre- and post-synaptic inhibition of sensory transmission during stimulus-produced or narcotic analgesia.     

Microfilament bundles in cultured cells : Correlation with anchorage independence and tumorigenicity in nude mice

The distribution of actin microfilament bundles in cell lines 3T3B, CHO, HeLa and CLID extracted with 0.1% Triton X-100 was examined by indirect immunofluorescence using human actin antibodies and by electron microscopy of whole cells grown directly on support grids. Anchorage dependence as determined by growth in soft agar and tumorigenicity in nude mice was also investigated. Immunofluorescent staining showed that CHO and HeLa cells have normal numbers and distributions of actin microfilament bundles as compared with similarly spread control 3T3B cells. A significant fraction of the mouse CLID cells showed comparable numbers of microfilament bundles as 3T3B cells but their distribution was markedly different. In many cases the bundles radiated from a region close to the cell's centre or near its projections and usually penetrated the projections. The presence of diffuse staining in 4% of the cell population also indicated the existence in these cells of disorganized actin. Electron microscope studies of well spread regions of negatively-stained, Triton-extracted cells corroborated the observations made with the immunofluorescence technique. In 3T3B, CHO and CLID cells abundant microtubules were found, colinearly arranged with actin filaments in the thin cytoplasmic extensions. While CLID, CHO and HeLa cells showed the capacity to grow in soft agar, only CLID and HeLa cells produced tumours in athymic nude mice. The observations suggest that a reduction or disorganisation of the actin microfilament bundles may not in itself be essential at least for the non-virally transformed cells studied to show anchorage independence or to produce tumours in nude mice.     

Plasmids required for utilization of molecular hydrogen by Alcaligenes eutrophus

Alcaligenes eutrophus and three other hydrogen bacteria exposed to plasmid-curing agents generated autotrophic-minus mutants at high frequency. These mutants were blocked in the metabolism of H₂ as an energy source and had normal levels of enzymes involved in CO₂ fixation. The loss of hydrogenase activity in A. eutrophus was accompanied by the loss or alteration of a plasmid that had molecular weight of approximately 200×10⁶. Mobilization of this plasmid from wild-type A. eutrophus strains into cured hydrogenase-minus derivatives restored hydrogenase function. It is concluded that A. eutrophus contains a large plasmid required for hydrogen metabolism and thereby autotrophic growth.Abbreviations Aut autotrophic - Hup hydrogen uptake - NTG N-methyl-N-nitro-N-nitrosoguanidine - RuBP ribulose bisphosphate - RuMP ribulose monophosphate - Kan kanamycin - Nal nalidixic acid - Rif rifampicin - Tet tetracycline     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Omega chain methylated analogs of PGF2α and PGE2

Our previously published prostaglandin (PG) synthesis route, in which the ω-chain is added in the penultimate step, provides facile access to a wide variety of ω-chain variant PG analogs. Each series requires only the synthesis of the appropriate methylated acylphosphonate for the Emmons' condensation. The syntheses of analogs bearing the following methylation pattern are detailed: 15-Me; 17, 17-(Me)₂; 17, 17, 20-(Me)₃; 18, 18, 20-(Me)₃; 15, 18, 18, 20-(Me)₄; and 15-Ome-18, 18, 20-(Me)₃. The well-known 16, 16-dimethyl prostaglandins have also been prepared by this sequence. The synthesis of 16, 16-tetramethylene-PG analogs is also described.     

NF1-related locus on chromosome 15

A neurofibromatosis type I (NF1)-related locus has been identified on chromosome 15. It contains a partial copy of the NF1 GAP-related domain, which is known to interact with the ras protooncogenes. However, the chromosome 15 sequence contains multiple deletions resulting in frameshift mutations and stop codons in several highly conserved sequence blocks. The locus on chromosome 15 therefore represents an NF1 pseudogene. This nonprocessed NF1 pseudogene may produce additional fragments in Southern blotting, pulsed-field gel, and PCR experiments with some NF1 cDNA probes or oligonucleotides. In addition, certain regions of the NF1 gene also cross-hybridize with a locus on chromosome 14. These loci must be considered in mutation analysis of patients with NF1 since aberrant findings may not always reflect changes in the NF1 gene.     

Papaverine reduces the sodium permeability of the apical membrane and the Potassium permeability of the basolateral membrane in isolated frog skin

Summary The effect of papaverine, an inhibitor of the phosphodiesterase responsible for breakdown of cAMP, on the transepithelial sodium transport across the isolated frog skin was investigated.Serosal addition of papaverine caused initially an increase in the short-circuit current (SCC), a doubling of the cellular cAMP content and a depolarization of the intracellular potential under SCC conditions (V _scc).The initial increase in the SCC was followed by a pronounced decrease both in the SCC and in the natriferic action of antidiuretic hormone (ADH), but papaverine had no inhibitory effect on the ability of ADH to increase the cellular cAMP content. As SCC declines, no hyperpolarization was observed.The I/V relationship across the apical membrane during the inhibitory phase, revealed that papaverine reduces the sodium permeability of the apical membrane (P _Na ^a )as well as intracellular sodium concentration. These observations and the previously noted effect of papaverine on V _scc indicates that papaverine must have an effect on the cellular Cl or K permeability.The basolateral Na,K,2Cl cotransporter was blocked with bumetanide, which should bring the cellular chloride in equilibrium. Bumetanide had no effect on basal SCC and V _scc. When papaverine was added to skins preincubated with bumetanide, the effect of papaverine on SCC and V _scc was unchanged. Therefore, the depolarization of V _scc, observed during the papaverine induced inhibition of the SCC, must be due to a reduction in the cellular K permeability.In conclusion, it is suggested that papaverine reduces the sodium permeability of the apical membrane and the potassium permeability of the basolateral membrane of the frog skin epithelium.     

Quantification of Rat Cerebral Cortex Na+,K+-ATPase: Effect of Age and Potassium Depletion

Na+,K(+)-ATPase concentration in rat cerebral cortex was studied by vanadate-facilitated [3H]ouabain binding to intact samples and by K(+)-dependent 3-O-methylfluorescein phosphatase activity determinations in crude homogenates. Methodological errors of both methods were evaluated. [3H]Ouabain binding to cerebral cortex obtained from 12-week-old rats measured incubating samples in buffer containing [3H]ouabain, and ouabain at a final concentration of 1 x 10(-6) mol/L gave a value of 11,351 +/- 177 (n = 5) pmol/g wet weight (mean +/- SEM) without any significant variation between the lobes. Evaluation of affinity for ouabain was in agreement with a heterogeneous population of [3H]ouabain binding sites. K(+)-dependent 3-O-methylfluorescein phosphatase activity in crude cerebral homogenates of age-matched rats was 7.24 +/- 0.14 (n = 5) mumol/min/g wet weight, corresponding to a Na+,K(+)-ATPase concentration of 12,209 +/- 236 pmol/g wet weight. It was concluded that the present methods were suitable for quantitative studies of cerebral cortex Na+,K(+)-ATPase. The concentration of rat cerebral cortex Na+,K(+)-ATPase showed approximately 10-fold increase within the first 4 weeks of life to reach a plateau of approximately 11,000-12,000 pmol/g wet weight, indicating a larger synthesis of Na+,K+ pumps than tissue mass in rat cerebral cortex during the first 4 weeks of development. K+ depletion induced by K(+)-deficient fodder for 2 weeks resulted in a slight tendency toward a reduction in K+ content (6%, p > 0.5) and Na+,K(+)-ATPase concentration (3%, p > 0.4) in cerebral cortex, whereas soleus muscle K+ content and Na+,K(+)-ATPase concentration were decreased by 30 (p < 0.02) and 32% (p < 0.001), respectively. Hence, during K+ depletion, cerebral cortex can maintain almost normal K+ homeostasis, whereas K+ as well as Na+,K+ pumps are lost from skeletal muscles.     

The functional unit of sarcoplasmic reticulum Ca2+-ATPase. Active site titration and fluorescence measurements

The properties of sarcoplasmic reticulum Ca2+-ATPase have been studied after modification of the ATP high affinity binding site with fluorescein isothiocyanate, both in the membranous state and after solubilization with the nonionic detergent, octaethyleneglycol monododecyl ether. Total inactivation of both membrane-bound and solubilized Ca2+-ATPase requires covalent attachment of 1 mol of fluorescein/mol of enzyme (115,000 g of protein) or per binding site for ATP. Sedimentation velocity studies of soluble enzyme showed that both unlabeled and fluorescein-labeled Ca2+-ATPase were present in a predominantly monomeric form. The phosphorylation level of unlabeled Ca2+-ATPase was unchanged by solubilization. Dephosphorylation measurements at 0 degree C indicated that the phosphorylation is an intermediate in the ATPase reaction catalyzed by solubilized Ca2+-ATPase. Fluorescein labeling of half of the Ca2+-ATPase in the membrane did not influence the enzyme kinetics of the remaining unmodified Ca2+-ATPase. Measurements of both fluorescein and tryptophan fluorescence indicated that the soluble monomer of Ca2+-ATPase like the membrane-bound enzyme exists in a Ca2+-dependent equilibrium between two principal conformations (E and E). E (absence of Ca2+) is unstable in the soluble form, but the pCa dependence of the E - E equilibrium is identical with that of the membranous Ca2+-ATPase (pCa0.5 = 6.7 and Hill coefficient 2). These results suggest that the Ca2+-ATPase polypeptides function with a high degree of independence in the membrane.