Design of (Gd-DO3A)n-polydiamidopropanoyl-peptide nucleic acid-D(Cys-Ser-Lys-Cys) magnetic resonance contrast agents

We hypothesized that chelating Gd(III) to 1,4,7-tris(carboxymethylaza)cyclododecane-10-azaacetylamide (DO3A) on peptide nucleic acid (PNA) hybridization probes would provide a magnetic resonance genetic imaging agent capable of hybridization to a specific mRNA. Because of the low sensitivity of Gd(III) as an magnetic resonance imaging (MRI) contrast agent, a single Gd-DO3A complex per PNA hybridization agent could not provide enough contrast for detection of cancer gene mRNAs, even at thousands of mRNA copies per cell. To increase the Gd(III) shift intensity of MRI genetic imaging agents, we extended a novel DO3An-polydiamidopropanoyl (PDAPm) dendrimer, up to n = 16, from the N-terminus of KRAS PNA hybridization agents by solid phase synthesis. A C-terminal D(Cys-Ser-Lys-Cys) cyclized peptide analog of insulin-like growth factor 1 (IGF1) was included to enable receptor-mediated cellular uptake. Molecular dynamic simulation of the (Gd-DO3A-AEEA)16-PDAP4-AEEA2-KRAS PNA-AEEA-D(Cys-Ser-Lys-Cys) genetic imaging nanoparticles in explicit water yielded a pair correlation function similar to that of PAMAM dendrimers, and a predicted structure in which the PDAP dendron did not sequester the PNA. Thermal melting measurements indicated that the size of the PDAP dendron included in the (DO3A-AEEA)n-PDAPm-AEEA2-KRAS PNA-AEEA-D(Cys-Ser-Lys-Cys) probes (up to 16 Gd(III) cations per PNA) did not depress the melting temperatures (Tm) of the complementary PNA/RNA hybrid duplexes. The Gd(III) dendrimer PNA genetic imaging agents in phantom solutions displayed significantly greater T1 relaxivity per probe (r1 = 30.64 +/- 2.68 mM(-1) s(-1) for n = 2, r1 = 153.84 +/- 11.28 mM(-1) s(-1) for n = 8) than Gd-DTPA (r1 = 10.35 +/- 0.37 mM(-1) s(-1)), but less than that of (Gd-DO3A)32-PAMAM dendrimer (r1 = 771.84 +/- 20.48 mM(-1) s(-1)) (P < 0.05). Higher generations of PDAP dendrimers with 32 or more Gd-DO3A residues attached to PNA-D(Cys-Ser-Lys-Cys) genetic imaging agents might provide greater contrast for more sensitive detection.     

Systems of Delivery of CRISPR/Cas9 Ribonucleoprotein Complexes for Genome Editing

Russian Journal of Bioorganic Chemistry - The discovery of RNA-guided nucleases have enabled to leap forward in genome editing of cells and organisms. These nucleases can be delivered into cells as...     

AmylPepPred: Amyloidogenic Peptide Prediction tool

We present an efficient computational architecture designed using supervised machine learning model to predict amyloid fibril forming protein segments, named AmylPepPred. The proposed prediction model is based on bio-physio-chemical properties of primary sequences and auto-correlation function of their amino acid indices. AmylPepPred provides a user friendly web interface for the researchers to easily observe the fibril forming and non-fibril forming hexmers in a given protein sequence. We expect that this stratagem will be highly encouraging in discovering fibril forming regions in proteins thereby benefit in finding therapeutic agents that specifically aim these sequences for the inhibition and cure of amyloid illnesses.

Availability

AmylPepPred is available freely for academic use at www.zoommicro.in/amylpeppred     

Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH₃)CH₂(RCl)(II-PS) and (RCl)CH₂N(CH₃)pGpsCpsAps TpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl=C₆H₄N(CH₃)(CH₂CH₂Cl) at the 3′- or 5′-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (att→∞) at 20°C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH₃)CH₂(RCl)(II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex. For Part III, see [1].     

Composites of peptide nucleic acids with ttitanium dioxide nanoparticles. I. Construction of nanocomposites containing DNA/PNA duplexes and their delivery into HeLa cells

In order to study the possibility of using titanium dioxide (TiO₂) nanoparticles to deliver peptide nucleic acids (PNA) in eukaryotic cells, a PNA oligomer was synthesized, and a method of PNA immobilization in the form of hybrid DNA/PNA duplexes on the surface of TiO₂ nanoparticles covered with polylysine (PL) was developed. The attachment of a DNA/PNA duplex to TiO₂ · PL nanoparticles occurs due to electrostatic interactions between the negatively charged DNA chain and the positively charged amino groups of PL. The binding of the PNA to the nanocomposite is achieved through noncovalent Watson-Crick interactions between PNA and complementary DNA. The capacity of the obtained TiO₂ · PL · DNA/PNA nano-composites depending on immobilization conditions was 10?C30 nmol PNA per 1 mg of TiO₂ particles, which corresponds to ??1?C3 PNA molecules per one TiO₂ particle with a size of 4?C6 nm. It was shown by confocal laser scanning microscopy that fluorescently-labeled PNA molecules in the TiO₂ · PL · DNA/^FluPNA nano-composites effectively penetrate into HeLa cells without transfection agents, electroporation, or other auxiliary procedures.     

The cyclooxygenases

Cyclooxygenases (COXs) catalyze the rate-limiting step in the production of prostaglandins, bioactive compounds involved in processes such as fever and sensitivity to pain, and are the target of aspirin-like drugs. COX genes have been cloned from coral, tunicates and vertebrates, and in all the phyla where they are found, there are two genes encoding two COX isoenzymes; it is unclear whether these genes arose from an early single duplication event or from multiple independent duplications in evolution. The intron-exon arrangement of COX genes is completely conserved in vertebrates and mostly conserved in all species. Exon boundaries largely define the four functional domains of the encoded protein: the amino-terminal hydrophobic signal peptide, the dimerization domain, the membrane-binding domain, and the catalytic domain. The catalytic domain of each enzyme contains distinct peroxidase and cyclooxygenase active sites; COXs are classified as members of the myeloperoxidase family. All COXs are homodimers and monotopic membrane proteins (inserted into only one leaflet of the membrane), and they appear to be targeted to the lumenal membrane of the endoplasmic reticulum, where they are N-glycosylated. In mammals, the two COX genes encode a constitutive isoenzyme (COX-1) and an inducible isoenzyme (COX-2); both are of significant pharmacological importance.     

Synthesis of novel polydiamidopropanoate dendrimer PNA-peptide chimeras for non-invasive magnetic resonance imaging of cancer

A variety of dendrimers can be conjugated to oligonucleotides to increase the number of contrast paramagnetic atoms (e.g., gadolinium or dysprosium) per probe. Thus, it was of interest to test a route for assembly of chelating dendrimer branches directly on the N-termini of peptide nucleic acid (PNA)-peptide chimeras by continuous solid-phase coupling on polymer supports. Dendrimer-PNA-peptides complementary to 12 nt of mutant KRAS mRNA have been prepared with a C-terminal insulin-like growth factor 1 (IGF1) analog d(Cys-Ser-Lys-Cys) and N-terminal polydiamidopropanoate (PDAP) dendrimers with different numbers of diaminopropanoate residues. 1,4, 7, 10-Tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) chelating moieties were then coupled to PDAP dendrimer-PNA-peptide chimeras before cleavage from the polymer supports. The DOTA-PDAP-PNA-peptide probes with 1, 2, 4, 8, or 16 amino (or DOTA) moieties were cleaved, purified by RP-HPLC, and characterized by MALDI-TOF mass spectroscopy.     

'Navius' kissing stents for coronary bifurcation stenosis,recreating a new metallic carina: an IVUS-assessed case report

We report a case of implantation of a new design of stent which allows creation of a double-hemispheric lumen for the treatment of a bifurcational stenosis. The unfavourable outcome following the implantation of this stent is described.