CDC25A pathway toward tumorigenesis: Molecular targets of CDC25A in cell-cycle regulation

The cell division cycle 25 (CDC25) phosphatases regulate key transitions between cell-cycle phases during normal cell division, and in the case of DNA damage, they are key targets of the checkpoint machinery that ensure genetic stability. Little is known about the mechanisms underlying dysregulation and downstream targets of CDC25. To understand these mechanisms, we silenced the CDC25A gene in breast cancer cell line MDA-MB-231 and studied downstream targets of CDC25A gene. MDA-MB-231 breast cancer cells were transfected and silenced by CDC25A small interfering RNA. Total messenger RNA (mRNA) was extracted and analyzed by quantitative real-time polymerase chain reaction. CDC25A phosphatase level was visualized by Western blot analysis and was analyzed by 2D electrophoresis and LC-ESI-MS/MS. After CDC25A silencing, cell proliferation reduced, and the expression of 12 proteins changed. These proteins are involved in cell-cycle regulation, programmed cell death, cell differentiation, regulation of gene expression, mRNA editing, protein folding, and cell signaling pathways. Five of these proteins, including ribosomal protein lateral stalk subunit P0, growth factor receptor bound protein 2, pyruvate kinase muscle 2, eukaryotic translation elongation factor 2, and calpain small subunit 1 increase the activity of cyclin D1. Our results suggest that CDC25A controls the cell proliferation and tumorigenesis by a change in expression of proteins involved in cyclin D1 regulation and G1/S transition.     

Actin is bundled in activation-tagged tobacco mutants that tolerate aluminum

A panel of aluminum-tolerant (AlRes) mutants was isolated by protoplast-based T-DNA activation tagging in the tobacco cultivar SR1. The mutants fell into two phenotypic classes: a minority of the mutants were fertile and developed similarly to the wild type (type I), the majority was male-sterile and grew as semi-dwarfs (type II). These traits, along with the aluminum tolerance, were inherited in a monogenic dominant manner. Both types of mutants were characterized by excessive bundling of actin microfilaments and by a strongly increased abundance of actin, a phenotype that could be partially phenocopied in the wild type by treatment with aluminum chloride. The actin bundles could be dissociated into finer strands by addition of exogenous auxin in both types of mutants. However, actin microfilaments and leaf expansion were sensitive to blockers of actin assembly in the wild type and in the mutants of type I, whereas they were more tolerant in the mutants of type II. The mutants of type II displayed a hypertrophic development of vasculature, manifest in form of supernumerary leaf veins and extended xylem layers in stems and petioles. Whereas mutants of type I were characterized by a normal, but aluminum-tolerant polar auxin-transport, auxin-transport was strongly promoted in the mutants of type II. The phenotype of these mutants is discussed in terms of reduced endocytosis leading, concomitantly with aluminum tolerance, to changes in polar auxin transport.     

Coral Reefs at the Northernmost Tip of Borneo: An Assessment of Scleractinian Species Richness Patterns and Benthic Reef Assemblages

The coral reefs at the northernmost tip of Sabah, Borneo will be established under a marine protected area: the Tun Mustapha Park (TMP) by the end of 2015. This area is a passage where the Sulu Sea meets the South China Sea and it is situated at the border of the area of maximum marine biodiversity, the Coral Triangle. The TMP includes fringing and patch reefs established on a relatively shallow sea floor. Surveys were carried out to examine features of the coral reefs in terms of scleractinian species richness, and benthic reef assemblages following the Reef Check substrate categories, with emphasis on hard coral cover. Variation in scleractinian diversity was based on the species composition of coral families Fungiidae (n = 39), Agariciidae (n = 30) and Euphylliidae (n = 15). The number of coral species was highest at reefs with a larger depth gradient i.e. at the periphery of the study area and in the deep South Banggi Channel. Average live hard coral cover across the sites was 49%. Only 7% of the examined reefs had > 75% hard coral cover, while the majority of the reef sites were rated fair (51%) and good (38%). Sites with low coral cover and high rubble fragments are evidence of blast fishing, although the observed damage appeared old. Depth was a dominant factor in influencing the coral species composition and benthic reef communities in the TMP. Besides filling in the information gaps regarding species richness and benthic cover for reef areas that were previously without any data, the results of this study together with information that is already available on the coral reefs of TMP will be used to make informed decisions on zoning plans for conservation priorities in the proposed park.     

Targeted Gene Delivery to MCF-7 Cells Using Peptide-Conjugated Polyethylenimine

Specific and effective delivery of drugs and genes to cancer cells are the major issues in successful cancer treatment. Recently, targeted cancer gene therapy has been emerged as a main technology for the treatment of different types of cancers. Among various synthetic carriers, polyethylenimine is one of the most well-known polymers for gene delivery. In this study, we conjugated phage-derived peptide (DMPGTVLP) to polyethylenimine (10 kDa) via disulfide bonds for targeted gene delivery into breast adenocarcinoma cells (MCF-7). As negative-control cells, we used non-related hepatocellular carcinoma cells (HepG2). Peptide-conjugated polyplex exhibited low cytotoxicity and significantly increased the transfection efficiency in comparison with unmodified polyethylenimine. Therefore, the peptide-modified vector can be used as a good targeting agent for gene or drug delivery into breast adenocarcinoma cells.

Electronic supplementary material

The online version of this article (doi:10.1208/s12249-014-0208-6) contains supplementary material, which is available to authorized users.KEY WORDS: breast cancer, gene therapy, phage-derived peptide, polyethylenimine     

Lead-induced oxidative stress and role of antioxidant defense in wheat ( Triticum aestivum L.)

The aim of this study was to investigate soil lead pollution on biochemical properties and gene expression pattern of antioxidant enzymes in three wheat cultivars (Morvarid, Gonbad and Tirgan) at flag leaf sheath swollen stage. Lead (Pb(NO3)2) was used at four different concentrations (0, 15, 30 and 45 mg/kg of soil). The leaf and roots samples were taken at late-booting stage (Zadoks code, GS: 45). The results showed that lead heavy metal toxicity increased the expression of some genes and the activity of key enzymes of the antioxidant defense system in wheat. Moreover, the cell oxidation levels (MDA, LOX) enhanced under lead stress conditions. The relative gene expression and activity of antioxidant enzymes (CAT, SOD, GPX and APX) increased significantly in the both leaves and root tissues under lead stress conditions. The level of gene expression and enzymatic activity were higher in the root than the leaf tissue. There was no significant difference among cultivars in each of lead concentrations but Morvarid and Tirgan cultivars had more tolerance to toxic concentrations of lead when compared to Gonbad cultivar.     

Simultaneous confidence intervals for quantile differences of several heterogeneous normal populations: With application to vitamin D supplement treatment on colorectal cancer patients

In many applications, comparing the q-quantiles of several normal populations are more advantageous than comparing their means. In this paper, we consider the problem of constructing simultaneous confidence intervals (SCIs) for quantile differences of several heterogeneous normal distributions. To the best of our knowledge, this problem remains unsolved. We propose a novel method for constructing a set of SCI. We propose two new sets of SCI by using the proposed technique and discuss two classic and two simulation-based SCIs. We show that the proposed classic SCIs are conservative for all population parameters configuration. We also show that the simulation-based SCIs have correct coverage probability asymptotically. We then compare these six sets of SCI in terms of average volume and coverage probability via an extensive simulation study. Results show that one of the proposed classic SCI can be recommended. Finally, the proposed methods are illustrated by a real example that is a vitamin D study on colorectal cancer patients.     

Binding of Leishmania spp with gold nanoparticles supported polyethylene glycol and its application for the sensitive detection of infectious photogenes in human plasma samples: A novel biosensor

The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH₂]₆ ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10^?6 to 10^?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.     

Evaluation of genetic diversity and population structure of Macqueen’s Bustard Chlamydotis macqueenii in Iran

Capsule: There is low genetic diversity in the Macqueen’s Bustard Chlamydotis macqueenii in Iran.

Aims: To investigate the genetic diversity and population structure of Macqueen’s Bustard in Iran, using two mitochondrial DNA loci.

Methods: Molecular diversity of the mitochondrial cytochrome oxidase c subunit I (COI) gene and part of the mitochondrial control region D-loop (in total 1183 base pairs) were analysed from 26 individual Macqueen’s Bustards from three regions of Iran.

Results: There was little variation in nucleotides and haplotypes in the populations for genes of both CR and COI. The population had free breeding and gene flow between the three study regions in Iran: Petregan, Ferdows and Yazd.

Conclusion: The use of molecular and genetic studies is essential to strengthen the protection of genetic diversity of the Macqueen’s Bustard.     

Microarray: gateway to unravel the mystery of abiotic stresses in plants

Environmental factors, such as drought, salinity, extreme temperature, ozone poisoning, metal toxicity etc., significantly affect crops. To study these factors and to design a possible remedy, biological experimental data concerning these crops requires the quantification of gene expression and comparative analyses at high throughput level. Development of microarrays is the platform to study the differential expression profiling of the targeted genes. This technology can be applied to gene expression studies, ranging from individual genes to whole genome level. It is now possible to perform the quantification of the differential expression of genes on a glass slide in a single experiment. This review documents recently published reports on the use of microarrays for the identification of genes in different plant species playing their role in different cellular networks under abiotic stresses. The regulation pattern of differentially-expressed genes, individually or in group form, may help us to study different pathways and functions at the cellular and molecular level. These studies can provide us with a lot of useful information to unravel the mystery of abiotic stresses in important crop plants.