Transfer and expression of the cryIVB and cryIVD genes of Bacillus thuringiensis subsp. israelensis in Bacillus sphaericus 2297

Abstract The genes encoding the CryIVB and CryIVD crystal polypeptides of B. thuringiensis subsp. israelensis were cloned indepently on a stable shuttle vector, and transfered into B. sphaericus 2297. Recombinant cells expressed the B. thuringiensis toxins during sporulation and were shown to be toxic to Aedes aegypti fourth instar larvae, whereas the parental strain was not.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Ploidy reduction and genome segregation in cultured carrot cell lines. I. Prophase chromosome reduction

Cytological analysis of different carrot cell lines in culture has shown various cytogenetic anomalies generating new levels of ploidy and novel chromosome numbers. Polyploidy may be considered a reservoir of variability that can be released in the form of distinct new segregants of different ploidy. Mechanisms alternative to mitosis (reductional grouping, prophase chromosome reduction) operate from a polyploid state (possibly reached by means of endopolyploidy, endomitosis, nuclear fusion, or restitution nuclei) to generate new levels of ploidy and novel chromosome numbers necessary for selection to operate in vitro. The segregational phenomena require chromosome recognition in haploid set complements and abnormal behaviour of mitoses; the resulting chromosome variability suggests that chromosomes are arranged, in the resting nuclei, in an orderly and predictable manner.The knowledge of the molecular events governing these mechanisms, and how to control them, would be of great help for future applications of plant cell culture.