Purification and characterization of glucose dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

Glucose dehydrogenase was purified to homogeneity from the thermoacidophilic archaebacterium Thermoplasma acidophilum. The enzyme is a tetramer of polypeptide chain Mr 38,000 +/- 3000, it is catalytically active with both NAD+ and NADP+ cofactors, and it is thermostable and remarkably resistant to a variety of organic solvents. The amino acid composition was determined and compared with those of the glucose dehydrogenases from the archaebacterium Sulfolobus solfataricus and the eubacteria Bacillus subtilis and Bacillus megaterium. The N-terminal amino acid sequence of the Thermoplasma acidophilum enzyme was determined to be: (S/T)-E-Q-K-A-I-V-T-D-A-P-K-G-G-V-K-Y-T-T-I-D-M-P-E.     

Purification and enzymic characterization of the cytoplasmic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

Cytoplasmic pyrophosphatase has been isolated from the thermoacidophilic archaebacterium Thermoplasma acidophilum. The enzyme was purified to electrophoretic homogeneity by combining ion-exchange and affinity-chromatographic separations. This soluble pyrophosphatase probably consists of six identical subunits, since SDS/PAGE gave an estimate of about 22 kDa for a single subunit and size-exclusion chromatography under non-denaturing conditions indicates a molecular mass of 110 +/- 5 kDa. The two most prominent catalytic features of this enzyme are the absolute requirement for divalent cations for catalytic action, Mg2+ conferring the highest activity, and the pronounced specificity for PPi. The catalytic behavior apparently follows simple Michaelis-Menten kinetics with a Km of about 7 microM for PPi and a specific activity of about 1200 U/mg at 56 degrees C. Surprisingly, maximum activity could be observed at 85 degrees C which is more than 20 degrees C above the temperature for optimal growth. Several cytoplasmic extracts of eubacteria and archaebacteria have been probed with a polyclonal antiserum raised against the purified archaebacterial protein. The only noticeable cross-reactivity could be detected with an extract from the methanogen Methanosarcina barkeri although this probably does not reflect the inferred phylogenetic relationship between methanogens and Thermoplasma acidophilum.     

Purification and characterization of a DNA polymerase from the archaebacterium Thermoplasma acidophilum

A thermophilic DNA polymerase has been purified to near homogeneity from the archaebacterium Thermoplasma acidophilum. Analysis of the purified enzyme by sodium dodecyl sulfate gel electrophoresis revealed a single polypeptide of 88 kDa which co-sediments with the DNA polymerase activity on sucrose gradients. Combination of sedimentation and gel filtration analyses indicates that this DNA polymerase is an 88-kDa monomeric enzyme in its native form. The DNA polymerase is resistant to aphidicolin, slightly sensitive to 2',3'-dideoxyribosylthymine triphosphate and inhibited by N-ethylmaleimide when preincubation with this reagent is performed at 65 degrees C. We find that a 3'----5' exonuclease activity is associated with the purified DNA polymerase; the two activities of the enzyme are optimal at 65 degrees C but the exonuclease activity is active in a broader range of lower temperatures and is more thermostable than the DNA polymerase activity.     

Crystallization and preliminary crystallographic study of glucose dehydrogenase from the archaebacterium Thermoplasma acidophilum

Single crystals of glucose dehydrogenase from the archaebacterium Thermoplasma acidophilum were obtained using the hanging-drop vapour diffusion method and polyethylene glycol as a precipitant in the presence of NADP+ at pH 5.4. The crystals belong to the hexagonal space group P6122 or P6522, with unit cell dimensions a = b = 121.9 angstrom, c = 229.6 angstrom and with two molecules in the asymmetric unit.     

Preliminary X-ray crystallographic study of malate dehydrogenases from the thermoacidophilic Archaebacteria Thermoplasma acidophilum and Sulfolobus acidocaldarius

Malate dehydrogenases from the thermoacidophilic Archaebacteria Thermoplasma acidophilum and Sulfolobus acidocaldarius have been crystallized and characterized by X-ray diffraction measurements. Crystals of the enzyme from T. acidophilum display space-group symmetry P2(1), a = 63 A, b = 135 A, c = 83 A and beta = 105 degrees; they scattered to approximately 4 A resolution. Two crystal modifications of malate dehydrogenase from S. acidocaldarius were characterized; one displayed trigonal symmetry corresponding to space groups P321, P3(1)21 or P3(2)21 with lattice parameters a = 151 A and c = 248 A and with resolution approximately to 5 A, whereas the other modification displayed space group symmetry I23 or I2(1)3 with lattice parameters a = 129 A and approximately 4.5 A resolution.     

Cloning and sequencing of the gene for the cytoplasmic inorganic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

The gene (ppa) from the thermoacidophilic archaebacterium Thermoplasma acidophilum, encoding the cytoplasmic pyrophosphatase, has been cloned. Two degenerate oligonucleotide probes, synthesized according to the N-terminal amino acid sequence of the isolated protein, were used to screen subgenomic libraries. The DNA-derived amino acid sequence of the archaebacterial enzyme allows, for the first time, comparative studies of cytoplasmic pyrophosphatases to be extended to all three urkingdoms. The archaebacterial pyrophosphatase more closely resembles the eubacterial enzymes on the basis of sequence similarity and subunit size. The majority of amino acid residues considered to be essential for hydrolysis of pyrophosphate seem to have been conserved throughout evolution, as inferred from the results of an alignment of sequences from all three urkingdoms.     

Purification and properties of NADH dehydrogenase from a thermoacidophilic archaebacterium, Sulfolobus acidocaldarius

An NADH dehydrogenase was purified to electrophoretical homogeneity from Sulfolobus acidocaldarius, a thermoacidophilic archaebacterium optimally growing at pH 2-3 and 75 degrees C. A 2,100-fold purification was achieved. The purified enzyme is an acidic protein with an isoelectric point of 5.6 and a molecular weight of 95,000, consisting of two 50,000-dalton subunits. The enzyme showed an absorption spectrum characteristic of flavoproteins, with maxima at 272, 372, and 448 nm. The enzyme is highly thermostable, is specific for NADH as an electron donor, and is capable of using 2,6-dichlorophenolindophenol, ferricyanide, benzoquinone, and naphthoquinone as electron acceptors. Though at a low rate, caldariellaquinone, a unique and sole benzothiophenequinone in the genus Sulfolobus, was also reduced by the enzyme, suggesting that the enzyme is a possible member of the respiratory chain of the thermoacidophilic archaebacterium.     

Purification and characterization of geranylgeranylglyceryl phosphate synthase from a thermoacidophilic archaeon,Thermoplasma acidophilum

We purified a geranylgeranylglyceryl phosphate (GGGP) synthase from Thermoplasma acidophilum by several steps of chromatography. Based on the proteinase-fragment-mass-pattern analysis of the SDS-PAGE band of the partially purified protein, the DNA sequence encoding the protein was identified from the whole genome sequence database of the species. The gene encoding GGGP synthase in T. acidophilum was cloned after PCR amplification of the gene from the genomic DNA. The recombinant enzyme was expressed in Escherichia coli and purified. A single band with a molecular mass of 27 kDa was obtained by SDS-PAGE analysis. The apparent native molecular mass of the enzyme was about 50 kDa based on gel filtration chromatography, suggesting that the enzyme is active as a homodimer. As the GGGP synthase from Methanobacterium thermoautotrophicum has been reported as a pentamer, the enzymes of the two organisms have different oligomeric structures. Other characteristics, including substrate specificity, are similar for the GGGPs of these organisms.     

Purification and properties of pyruvate kinase from Thermoplasma acidophilum

Thermoplasma acidophilum is a thermoacidophilic archaebacterium occupying a paradoxical place in phylogenetic trees (phenotypically it is a thermoacidophile but phylogenetically it classifies with the methanogens). To better understand its phylogeny, the pyruvate kinase from this organism is being investigated as a molecular marker. The enzyme has been purified and has a native M(r) of 250,000. It consists of four, apparently identical subunits each of M(r) 60,000. No remarkable kinetic differences have been found between this thermophilic enzyme and its mesophilic counterparts other than its greater thermostability. Its amino acid composition has been determined and some partial sequencing has been done.     

Characterization of the DNA gyrase from the thermoacidophilic archaeon Thermoplasma acidophilum

Thermoplasma acidophilum is sensitive to the antibiotic drug novobiocin, which inhibits DNA gyrase. We characterized DNA gyrases from T. acidophilum strains in vitro. The DNA gyrase from a novobiocin-resistant strain and an engineered mutant were less sensitive to novobiocin. The novobiocin-resistant gyrase genes might serve as T. acidophilum genetic markers.     

Analysis of bacterial glucose dehydrogenase homologs from thermoacidophilic archaeon Thermoplasma acidophilum: finding and characterization of aldohexose dehydrogenase

The NADP(+)-preferring glucose dehydrogenase from thermoacidophilic archaeon Thermoplasma acidophilum has been characterized, and its crystal structure has been determined (Structure, 2:385-393, 1994). Its sequence and structure are not homologous to bacterial NAD(P)(+)-dependent glucose dehydrogenases, and its molecular weight is also quite defferent. On the other hand, three functionally unknown genes with homologies to bacterial NAD(P)(+)-dependent glucose dehydrogenases have been sequenced as part of the T. acidophilum genome project (gene names: Ta0191, Ta0747, and Ta0754 respectively). We expressed two genes of three, Ta0191 and Ta0754, in Escherichia coli, and purified the gene products to homogeneity. Dehydrogenase activities were thereby detected from the purified proteins. The Ta0754 gene product exhibited aldohexose dehydrogenase activity, and the Ta0191 gene product exhibited weak 2-deoxyglucose dehydrogenase activity. No aldohexose dehydrogenase gene has been isolated, while the enzyme was reported in 1968. This is the first report of the gene and primary structure. The purified Ta0754 gene product, designated AldT, was characterized. The enzyme AldT effectively catalyzed the oxidation of various aldohexoses, especially D-mannose. Lower activities on D-2-deoxyglucose, D-xylose, D-glucose, and D-fucose were detected although no activities were shown on other aldohexoses or additional sugars. As a cofactor, NAD(+) was much more suitable for the activity than NADP(+). The NAD(+)-preferring dehydrogenase most effectively reacting to D-mannose is for the first time. AldT was most active at pH 10 and above 70 degrees C, and completely stable up to 60 degrees C after incubation for 15 min. Other enzymatic properties were also investigated.     

The nucleotide sequence of the tRNAMMet from the archaebacterium Thermoplasma acidophilum.

Using in vitro labelling techniques, a tRNAMMet from Thermoplasma acidophilum, a member of the Archaebacteriae, has been shown to have the sequence: pGCCGGG Gs4UGGCUCANCUGGAGGAGC m2(2)GCCGGACmUCAUt6AAUCCGGAGGUCUCGGG psi psi CmGAUCCCCGAUCCCGGCACCAOH. Despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. There is no close sequence homology between this tRNA and that of any other methionine tRNA so far sequenced (less than 70%) but it has almost 90% homology with the nucleotide sequence proposed by Eigen and Oswatitsch for the ancestral quasi-species.     

Crystalline NAD/NADP-dependent malate dehydrogenase; the enzyme from the thermoacidophilic archaebacterium Sulfolobus acidocaldarius

Malate dehydrogenase from Sulfolobus acidocaldarius has been purified 240-fold to apparent electrophoretic homogeneity. The enzyme shows a specific activity of 277 U/mg and crystallizes readily. The relative molecular mass of the native enzyme is estimated as 128,500 by ultracentrifugation. After cross-linking a relative molecular mass of 134,000 is found by sodium dodecyl sulfate gel electrophoresis. Malate dehydrogenase from S. acidocaldarius is composed of four subunits of identical size with a relative molecular mass of 34,000. Active-enzyme sedimentation in the analytical ultracentrifuge indicates that the tetramer is the catalytically active species. Kinetic studies in the direction of oxaloacetate reduction showed a Km for NADH of 4.1 microM and a Km for oxaloacetate of 52 microM. Oxaloacetate exhibits substrate inhibition at higher concentrations, L-malate, NAD and NADP were found to be product inhibitors. The enzymatic activity is inhibited by 2-oxoglutarate but not by the adenosine nucleotides AMP, ADP and ATP. Only low activity is detected in the direction of malate oxidation. Malate dehydrogenase from S. acidocaldarius utilizes both NADH and NADPH to reduce oxaloacetate. The enzyme shows A-side stereospecificity for both nicotinamide dinucleotides.     

Glutamate dehydrogenase from the thermoacidophilic archaebacterium Sulfolobus solfataricus

An NAD(P)-dependent glutamate dehydrogenase was purified to homogeneity from the thermoacidophilic archaebacterium Sulfolobus solfataricus. The enzyme is a hexamer (subunit mass 45 kDa) which dissociates into lower states of association when submitted to gel filtration. Isoelectric focusing analysis of the purified enzyme showed a pI of 5.7 and occasionally revealed microheterogeneity. The enzyme is strictly specific for the natural substrates 2-oxoglutarate and L-glutamate, but is active with both NADH and NADPH. S. solfataricus glutamate dehydrogenase revealed a high degree of thermal stability (at 80 C the half-life was 15 h) which was strictly dependent on the protein concentration. Very high levels of glutamate dehydrogenase were found in this archaebacterium which suggests that the conversion of 2-oxoglutarate and ammonia to glutamate is of central importance to the nitrogen metabolism in this bacterium.     

Archaebacterial malate dehydrogenases. The enzymes from the thermoacidophilic organisms Sulfolobus acidocaldarius and Thermoplasma acidophilum show A-side stereospecificity for NAD+.

The stereoselective transfer of hydrogen from NADH to oxaloacetate catalysed by malate dehydrogenases (EC 1.1.1.37) from the thermoacidophilic archaebacteria Sulfolobus acidocaldarius and Thermoplasma acidophilum was studied by the p.m.r. method described by Zhou & Wong [(1981) J. Biochem. Biophys. Methods 4, 329-338]. Both enzymes are A-side (pro-R) stereospecific for NADH.     

Structural analysis of the plasmid pTA1 isolated from the thermoacidophilic archaeon Thermoplasma acidophilum

Thermoplasma acidophilum is a thermoacidophilic archaeon that grows optimally at pH1.8 and 56°C and has no cell wall. Plasmid pTA1 was found in some strains of the species. We sequenced plasmid pTA1 and analyzed the open reading frames (ORFs). pTA1 was found to be a circular DNA molecule of 15,723 bp. Eighteen ORFs were found; none of the gene products except ORF1 had sequence similarity to known proteins. ORF1 showed similarity to Cdc6, which is involved in genome-replication initiation in Eukarya and Archaea. T. acidophilum has two Cdc6 homologues in the genome. The homologue found in pTA1 is most similar to Tvo3, one of the three Cdc6 homologues found in the genome of Thermoplasma volcanium, among all of the Cdc6 family proteins. The phylogenetic analysis suggested that plasmid pTA1 is possibly originated from the chromosomal DNA of Thermoplasma.     

Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences.     

The plasmids found in isolates of the acidothermophilic archaebacterium Thermoplasma acidophilum

Abstract Plasmids were detected in isolates of an acidothermophilic archaebacterium Thermoplasma acidophilum . One of the plasmids, pTA1, was characterized. The plasmid was a circular DNA of 15.2 kbp. A physical map was constructed using three restriction endonucleases. A copy number of this plasmid was estimated to be 7–13 per cell. The homologous sequence was not found in the chromosomal DNA of the host cell.     

Glucose dehydrogenase from the thermoacidophilic archaebacterium Sulfolobus solfataricus.

Glucose dehydrogenase has been purified to homogeneity from cell extracts of the extreme thermoacidophilic archaebacterium Sulfolobus solfataricus. The enzyme utilizes both NAD+ and NADP+ as coenzyme and catalyses the oxidation of several monosaccharides to the corresponding glyconic acid. Substrate specificity and oxidation rate depend on the coenzyme present; when NAD+ is used, the enzyme binds and oxidizes specifically sugars presenting equatorial orientation of hydroxy groups at C-2, C-3 and C-4. The Mr of the native enzyme is 124,000 and decreases to about 60,000 in the presence of 6 M-guanidinium chloride and to about 30,000 in the presence of 5% (w/v) SDS. The enzyme shows maximal activity at pH 9, 77 degrees C and 20 mM-Mg2+, -Mn2+ or -Ca2+ and is fairly stable in the presence of chaotropic agents and water-miscible organic solvents such as methanol or acetone.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.