Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles

The CGG repeat in the 5' untranslated region of the fragile X mental retardation 1 gene (FMR1) exhibits remarkable instability upon transmission from mothers with premutation alleles. A collaboration of 13 laboratories in eight countries was established to examine four issues concerning FMR1 CGG-repeat instability among females with premutation (approximately 55-200 repeats) and intermediate (approximately 46-60 repeats) alleles. Our central findings were as follows: (1) The smallest premutation alleles that expanded to a full mutation (>200 repeats) in one generation contained 59 repeats; sequence analysis of the 59-repeat alleles from these two females revealed no AGG interruptions within the FMR1 CGG repeat. (2) When we corrected for ascertainment and recalculated the risks of expansion to a full mutation, we found that the risks for premutation alleles with <100 repeats were lower than those previously published. (3) When we examined the possible influence of sex of offspring on transmission of a full mutation-by analysis of 567 prenatal fragile X studies of 448 mothers with premutation and full-mutation alleles-we found no significant differences in the proportion of full-mutation alleles in male or female fetuses. (4) When we examined 136 transmissions of intermediate alleles from 92 mothers with no family history of fragile X, we found that, in contrast to the instability observed in families with fragile X, most (99/136 [72.8%]) transmissions of intermediate alleles were stable. The unstable transmissions (37/136 [27.2%]) in these families included both expansions and contractions in repeat size. The instability increased with the larger intermediate alleles (19% for 49-54 repeats, 30.9% for 55-59, and 80% for 60-65 repeats). These studies should allow improved risk assessments for genetic counseling of women with premutation or intermediate-size alleles.     

Methylation mosaicism of 5'-(CGG)(n)-3' repeats in fragile X, premutation and normal individuals

Fragile X syndrome (FRAXA) is characterized at the molecular level by an expansion of a naturally occurring 5′-(CGG)_n-3′ repeat in the promoter and 5′-untranslated region (5′-UTR) of the fragile X mental retardation (FMR1) gene on human chromosome Xq27.3. When expanded, this region is usually hypermethylated. Inactivation of the FMR1 promoter and absence of the FMR1 protein are the likely cause of the syndrome. By using the bisulfite protocol of the genomic sequencing method, we have determined the methylation patterns in this region on single chromosomes of healthy individuals and of selected premutation carriers and FRAXA patients. In control experiments with unmethylated or M-SssI-premethylated DNAs, this protocol has been ascertained to reliably detect all cytidines or 5-methylcytidines as unmethylated or methylated nucleotides, respectively. Analyses of the DNA from FRAXA patients reveal considerable variability in the lengths of the 5′-(CGG)_n-3′ repeats and in the levels of methylation in the repeat and the 5′-UTR. In one patient (OEl) with high repeat length heterogeneity (n = 15 to >200), shorter repeats (n = 20–80) were methylated or unmethylated, longer repeats (n = 100–150) were often completely methylated, but one repeat with n = 160 proved to be completely unmethylated. This type of methylation mosaicism was observed in several FRAXA patients. In healthy females, methylated 5′-CG-3′ sequences were found in some repeats and 5′-UTRs, as expected for the sequences from one of the X chromosomes. The natural FMR1 promoter is methylation sensitive, as demonstrated by the loss of activity in transfection experiments using the unmethylated or M-SssI-premethylated FMR1 promoter fused to the luciferase gene as an activity indicator.     

Secondary structure and dynamics of the r(CGG) repeat in the mRNA of the fragile X mental retardation 1 (FMR1) gene.

The CGG triplet repeat found within the 5'UTR of the FMR1 gene is involved in the pathogenesis of both fragile X syndrome and fragile X-associated tremor/ataxia syndrome (FXTAS). The repeat has been shown to form both hairpins and tetraplexes in DNA; however, the secondary structure of CGG-repeat RNA has not been well defined. To this end, we have performed NMR spectroscopy on in vitro transcribed CGG-repeat RNAs and see clear evidence of intramolecular hairpins, with no evidence of tetraplex structures. Both C*G and G*G base pairs form in the hairpin stem, though in a dynamic equilibrium of conformations. In addition, we investigated the effect of an AGG repeat interruption on hairpin stability; such interruptions are often interspersed within the CGG repeat element and are thought to modulate secondary structure of the RNA. While the AGG repeat lowers the Tm of the hairpin at low Mg2+ concentrations, this difference disappears at physiological Mg2+ levels.     

Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical structures

Fragile X syndrome is caused by expansion of a d(CGG) trinucleotide repeat sequence in the 5′ untranslated region of the first exon of the FMR1 gene. Repeat expansion is thought to be instigated by formation of d(CGG)_n secondary structures. Stable FMR1 d(CGG)_n runs in normal individuals consist of 6–52 d(CGG) repeats that are interrupted every 9–11 triplets by a single d(AGG) trinucleotide. By contrast, individuals having fragile X syndrome premutation or full mutation present >54–200 or >200–2000 monotonous d(CGG) repeats, respectively. Here we show that the presence of interspersed d(AGG) triplets diminished in vitro formation of bimolecular tetrahelical structures of d(CGG)₁₈ oligomers. Tetraplex structures formed by d(CGG)_n oligomers containing d(AGG) interspersions had lower thermal stability. In addition, tetraplex structures of d(CGG)₁₈ oligomers interspersed by d(AGG) triplets were unwound by human Werner syndrome DNA helicase at rates and to an extent that exceeded the unwinding of tetraplex form consisting of monotonous d(CGG)₁₈. Diminished formation and stability of tetraplex structures of d(AGG)-containing FMR1 d(CGG)_2–50 tracts might restrict their expansion in normal individuals.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Molecular analysis of the (CGG)n expansion in the FMR-1 gene in 59 Spanish fragile X syndrome families

The fragile X mental retardation syndrome is caused by an expansion of a trinucleotide repeat (CGG)_n in the FMR-1 gene. Molecular genetic study of fragile X provides accurate diagnosis and facilitates genetic counseling in families with affected members. We present here the molecular study of 59 Spanish fragile X syndrome families using probe StB 12.3 and the polymerase chain reaction (PCR) of the (CGG)_n repeat sequence of the FMR-1 gene. The results obtained have allowed us to characterize 455 individuals, including eight prenatal diagnoses. The clinical diagnosis of fragile X in 89 affected males was confirmed, 137 female carriers were identified (48 of whom were mentally retarded), 176 individuals at risk were found not to have the expansion, and 12 cases of normal transmitting males (NTM) were detected. In the sample studied, no de novo mutations were detected, nor any mutation different from that described for the (CGG)_n expansion. One nonmentally retarded male was detected as having an unmethylated CpG island for the FMR-1 gene, but with more than 200 CGG repeats (high functioning male). The analysis of the (CGG)_n repeat in 208 normal chromosomes gave an allele distribution similar to that in other Caucasoid population groups, with alleles of 29 and 30 CGG repeats accounting for 46% of the chromosomes. The combination of Southern analysis and PCR of the (CGG)_n repeat is highly efficient for diagnosis, compared with cytogenetic techniques, especially in the detection of female carriers, NTMs, and prenatal diagnosis, enabling accurate genetic counseling to be provided in all cases.     

Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n

Formation of hairpin or tetraplex structures of the FMR1 gene d(CGG)_n sequence triggers its expansion, setting off fragile X syndrome. In searching for proteins that destabilize d(CGG)_n secondary structures we purified from rat liver quadruplex telomeric DNA binding protein 42 (qTBP42) that disrupts G′2 bimolecular tetraplex d(CGG)_n while paradoxically stabilizing the G′2 structure of the telomeric sequence d(TTAGGG)_n. Based on peptide sequence homology of qTBP42 and mouse CArG-box binding factor A (CBF-A), we provide direct evidence that recombinant CBF-A protein is physically and immunochemically indistinguishable from qTBP42 and that it too destabilizes G′2 d(CGG)_n while stabilizing G′2 d(TTAGGG)_n. We inquired whether CBF-A employs the same or different domains to differentially interact with G′2 d(CGG)_n and G′2 d(TTAGGG)_n. Mutant CBF-A proteins that lack each or combinations of its five conserved motifs: RNP1₁, RNP1₂, RNP2₁, RNP2₂ and ATP/GTP-binding box were tested for their G′2 d(CGG)_n destabilization and G′2 d(TTAGGG)_n stabilization activities. We find that either RNP1₁ or the ATP/GTP motifs are necessary and sufficient for G′2 d(CGG)_n destabilization whereas RNP2₁ suppresses destabilization by either one of these two motifs. Neither RNP1₁ nor the ATP/GTP motif are required for G′2 d(TTAGGG)_n stabilization. Hence, CBF-A employs different domains to destabilize G′2 d(CGG)_n or stabilize G′2 d(TTAGGG)_n.     

Destabilization of tetraplex structures of the fragile X repeat sequence (CGG)n is mediated by homolog-conserved domains in three members of the hnRNP family

Hairpin or tetrahelical structures formed by a d(CGG)_n sequence in the FMR1 gene are thought to promote expansion of the repeat tract. Subsequent to this expansion FMR1 is silenced and fragile X syndrome ensues. The injurious effects of d(CGG)_n secondary structures may potentially be countered by agents that act to decrease their stability. We showed previously that the hnRNP-related protein CBF-A destabilized G′2 bimolecular tetraplex structures of d(CGG)_n. Analysis of mutant proteins revealed that the CBF-A-conserved domains RNP1₁ and ATP/GTP binding box were sufficient and necessary for G′2 d(CGG)_n disruption while the RNP2₁ motif inhibited the destabilization activity. Here, we report that a C-terminal fragment of CBF-A whose only remaining conserved domain was the ATP/GTP binding motif, disrupted G′2 d(CGG)_n more selectively than wild-type CBF-A. Further, two additional members of the hnRNP family, hnRNP A2 and mutant hnRNP A1 effectively destabilized G′2 d(CGG)_n. Examination of mutant hnRNP A2 proteins revealed that, similar to CBF-A, their RNP1₁ element and ATP/GTP binding motif mediated G′2 d(CGG)_n disruption, while the RNP2₁ element blocked their action. Similarly, the RNP1₁ and RNP2₁ domains of hnRNP A1 were, respectively, positive and negative mediators of G′2 d(CGG)_n destabilization. Last, employing the same conserved motifs that mediated disruption of the DNA tetraplex G′2 d(CGG)_n, hnRNP A2 destabilized r(CGG)_n RNA tetraplex.     

Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG)(n) might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG)(n) are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482) and unimolecular quadruplex telomeric DNA-binding protein 25 (uqTBP25) (Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 15881-15890). Blunt-ended and 3'-tailed or 3'- and 5'-tailed bimolecular tetraplex structures of d(CGG)(n) and guanine-sparse 20-/46-mer partial DNA duplex were progressively destabilized by increasing amounts of qTBP42 or uqTBP25 in time-dependent and ATP- or Mg(2+)-independent reactions. By contrast, tetraplex structures of telomeric and IgG sequences or guanine-rich double-stranded DNA resisted destabilization by qTBP42 or uqTBP25. Increased stability of tetraplex d(CGG)(n) in the presence of K(+) or Na(+) ions or at lowered reaction temperature diminished the destabilizing activity of uqTBP25. The contrasting stabilization of tetraplex telomeric DNA and destabilization of tetraplex d(CGG)(n) by qTBP42 and uqTBP25 suggested that sequence or structural differences between these tetraplexes might serve as cues for the differential stabilizing/destabilizing activities.     

Fragile X syndrome and the (CGG)n mutation: two families with discordant MZ twins.

The fragile X phenotype has been found, in the majority of cases, to be due to the expansion of a CGG repeat in the 5'-UTR region of the FMR-1 gene, accompanied by methylation of the adjacent CpG island and inactivation of the FMR-1 gene. Although several important aspects of the genetics of fragile X have been resolved, it remains to be elucidated at which stage in development the transition from the premutation to the full mutation occurs. We present two families in which discordance between two sets of MZ twins illustrates two important genetic points. In one family, two affected MZ brothers differed in the number of CGG repeats, demonstrating in vivo mitotic instability of this CGG repeat and suggesting that the transition to the full mutation occurred postzygotically. In the second family, two MZ sisters had the same number of repeats, but only one was mentally retarded. When the methylation status of the FMR-1 CpG island was studied, we found that the majority of normal chromosomes had been inactivated in the affected twin, thus leading to the expression of the fragile X phenotype.     

The porphyrin TMPyP4 inhibits elongation during the noncanonical translation of the FTLD/ALS-associated GGGGCC repeat in the C9orf72 gene

GGGGCC (G₄C₂) repeat expansion in the C9orf72 gene has been shown to cause frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Dipeptide repeat proteins produced through repeat-associated non-AUG (RAN) translation are recognized as potential drivers for neurodegeneration. Therefore, selective inhibition of RAN translation could be a therapeutic avenue to treat these neurodegenerative diseases. It was previously known that the porphyrin TMPyP4 binds to G₄C₂ repeat RNA. However, the consequences of this interaction have not been well characterized. Here, we confirmed that TMPyP4 inhibits C9orf72 G₄C₂ repeat translation in cellular and in in vitro translation systems. An artificial insertion of an AUG codon failed to cancel the translation inhibition, suggesting that TMPyP4 acts downstream of non-AUG translation initiation. Polysome profiling assays also revealed polysome retention on G₄C₂ repeat RNA, along with inhibition of translation, indicating that elongating ribosomes stall on G₄C₂ repeat RNA. Urea-resistant interaction between G₄C₂ repeat RNA and TMPyP4 likely contributes to this ribosome stalling and thus to selective inhibition of RAN translation. Taken together, our data reveal a novel mode of action of TMPyP4 as an inhibitor of G₄C₂ repeat translation elongation.     

Solution structures of the individual single strands of the fragile X DNA triplets (GCC)n.(GGC)n.

Three-dimensional structures of the fragile X triplet repeats (GCC)n and (GGC)n are derived by using one- dimensional/two-dimensional NMR. Under a wide range of solution conditions (10-150 mM NaCl,pH6-7)(GCC)5-7 strands form exclusively slipped hairpins with a 3' overhanging C. The slipped hairpins of (GCC)n strands show the following structural characteristics: (i) maximization of Watson-Crick G.C pairs; (ii) formation of C.C mispairs at the CpG steps in the stem; (iii) C2'-endo, anti conformations for all the nucleotides. The ability of (GCC)n strands to form hairpin structures more readily than complementary (GGC)n strands suggests preferential slippage during replication and subsequent expansion of the (GCC)n strands. In addition, the C.C. mispairs at the CpG site of (GCC)n hairpins account for their exceptional substrate efficiencies for human methyltransferase. Gel electrophoresis data show that (GGC)n strands form both hairpin and mismatched duplex structures in 10-150 mM NaCl (ph 6-7) for n < 10, but for n > or + 11 hairpin structures are exclusively present. However, (GGC)n strands remain predominantly in the duplex state for n=4-11 under NMR solution conditions, which require DNA concentrations 100- to 1000-fold higher than in gel electrophoresis. NMR analyses of [(GGC)n]2 duplexes for n=4-6 show the presence of Watson-Crick G.C and mismatched G anti G syn pairs. The mismatches adjacent to the CpG step introduce local structural flexibility in these duplexes. Similar structural properties are also expected in the stem of the hairpins formed by (GGC)n strands.     

Influence of pH, temperature and the cationic porphyrin TMPyP4 on the stability of the i-motif formed by the 5'-(C3TA2)4-3' sequence of the human telomere

The influence of pH, temperature and the cationic porphyrin TMPyP4 on the conformational equilibria of the cytosine-rich strand of the human telomeric sequence 5′-(C₃TA₂)₄-3′, as well as those of the sequence 5′-(C₃TT₂)₄-3′, was studied. The presence of adenine bases at the loops causes the formation of two different intramolecular i-motif structures with a pH-transition midpoint around 4.6, which stability is lower than the i-motif formed by the sequence 5′-(C₃TT₂)₄-3′. The stoichiometries of the complexes formed by these i-motif structures with TMPyP4 are also influenced by the presence of adenine at the loops.     

Evaluation of the fragile X (FRAXA) syndrome with methylation-sensitive PCR

The fragile X (FRAXA) syndrome is the most common form of inherited mental retardation in males. Its peculiar pattern of inheritance results from the parent of origin-specific expansion of a CGG-repeat within the FMR1 gene on the X chromosome. In patients, gene function is abolished by hypermethylation of the promoter and the massively expanded repeat. We have developed a methylation-sensitive polymerase chain reaction (MS-PCR) strategy that combines repeat-length and methylation analysis of the CGG-repeat and the promoters of the FMR1 and XIST genes. The allelic methylation of the latter opposes that of the FMR promoter and serves as an internal control and standard for semiquantitative analyses. This system enables the delineation of 11 distinct patterns encountered in nonaffected, carrier, and affected males and females. We have evaluated our system on well-defined samples with different FMR1 mutations and have used it for the diagnostic evaluation of 253 male and 80 female probands. In the male group, we have identified five full mutations, and three gray-zone and premutation alleles with 54, 55, and 62 repeats, respectively. The female group consists of 33 normal homozygote and 41 heterozygote individuals, two of whom harbor a gray-zone allele with 47 repeats, none with a premutation, and six with a full mutation. Our MS-PCR approach allows the currently most comprehensive diagnostic evaluation of the FRAXA syndrome in a cost- and time-efficient fashion. In addition, it is a valuable tool for the analysis of clonality and skewing phenomena in females.     

Binding of eukaryotic translation initiation factor 4E (eIF4E) to eIF4G represses translation of uncapped mRNA.

mRNA translation in crude extracts from the yeast Saccharomyces cerevisiae is stimulated by the cap structure and the poly(A) tail through the binding of the cap-binding protein eukaryotic translation initiation factor 4E (eIF4E) and the poly(A) tail-binding protein Pab1p. These proteins also bind to the translation initiation factor eIF4G and thereby link the mRNA to the general translational apparatus. In contrast, uncapped, poly(A)-deficient mRNA is translated poorly in yeast extracts, in part because of the absence of eIF4E and Pab1p binding sites on the mRNA. Here, we report that uncapped-mRNA translation is also repressed in yeast extracts due to the binding of eIF4E to eIF4G. Specifically, we find that mutations which weaken the eIF4E binding site on the yeast eIF4G proteins Tif4631p and Tif4632p lead to temperature-sensitive growth in vivo and the stimulation of uncapped-mRNA translation in vitro. A mutation in eIF4E which disturbs its ability to interact with eIF4G also leads to a stimulation of uncapped-mRNA translation in vitro. Finally, overexpression of eIF4E in vivo or the addition of excess eIF4E in vitro reverses these effects of the mutations. These data support the hypothesis that the eIF4G protein can efficiently stimulate translation of exogenous uncapped mRNA in extracts but is prevented from doing so as a result of its association with eIF4E. They also suggest that some mRNAs may be translationally regulated in vivo in response to the amount of free eIF4G in the cell.     

Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome.

Fragile X syndrome is the most frequent form of inherited mental retardation and is associated with a fragile site at Xq27.3. We identified human YAC clones that span fragile X site-induced translocation breakpoints coincident with the fragile X site. A gene (FMR-1) was identified within a four cosmid contig of YAC DNA that expresses a 4.8 kb message in human brain. Within a 7.4 kb EcoRI genomic fragment, containing FMR-1 exonic sequences distal to a CpG island previously shown to be hypermethylated in fragile X patients, is a fragile X site-induced breakpoint cluster region that exhibits length variation in fragile X chromosomes. This fragment contains a lengthy CGG repeat that is 250 bp distal of the CpG island and maps within a FMR-1 exon. Localization of the brain-expressed FMR-1 gene to this EcoRI fragment suggests the involvement of this gene in the phenotypic expression of the fragile X syndrome.