Sequences flanking the hexameric G-box core CACGTG affect the specificity of protein binding.

The CACGTG G-box motif is a highly conserved DNA sequence that has been identified in the 5' upstream region of plant genes exhibiting regulation by a variety of environmental signals and physiological cues. Gel mobility shift assays using a panel of G-box oligonucleotides differing in their flanking sequences identified two types of binding activity (A and B) in a cauliflower nuclear extract. Competition gel retardation assays demonstrated that the two types of binding activity were distinct. Type A binding activity interacted with oligonucleotides designated as class I elements, whereas type B binding activity interacted strongly with class II elements and weakly with class I elements. A third class of elements, null elements, did not exhibit any detectable binding under our assay conditions. Gel retardation analysis of nonpalindromic hybrid G-box oligonucleotides indicated that hybrid elements of the same class exhibited binding affinity commensurate with the affinity of the weaker element, hybrid class I/II elements exhibited only type B binding, and hybrid class I/null and class II/null elements did not show any detectable binding activity. These binding activities can be explained by the affinity of bZip G-box binding homo- or heterodimer subunits for G-box half sites. These experiments led to a set of classification rules that can predict the binding activity of all reported plant G-box motifs containing the consensus hexameric core. Tissue- and/or development-specific expression of genes containing G-box motifs may be regulated by the affinity of G-box proteins for the different classes of G-box elements.     

Characterization of a maize G-box binding factor that is induced by hypoxia

G-box cis-acting DNA sequence elements are present in the promoter region of a number of signal-inducible plant genes. In many cases this motif is essential for gene expression. Maize nuclear extracts contain a protein complex that binds specifically to the G-box sequence. Previously, a protein called GF14 was described that is physically associated with the G-box binding complex, but is not a DNA-binding factor in and of itself. This paper reports the isolation of a cDNA encoding a maize G-box binding factor (GBF). The deduced amino acid sequence indicates that maize GBF1 is a basic region-leucine zipper protein. GBF1 binds to the G-box element with specificity similar to that of the binding activity in nuclear extracts. Furthermore, maize GBF1 and the factor detected in nuclear extract are identical in their molecular weight and are immunologically related. GBF1 mRNA accumulates rapidly in hypoxically induced maize cells prior to the increase in Adh1 mRNA levels. Taken together with results that indicate that GBF1 binds to the hypoxia-responsive promoter of maize Adh1, these observations suggest that GBF1 may be one of the factors involved in the activation of Adh1.     

The G-box: a ubiquitous regulatory DNA element in plants bound by the GBF family of bZIP proteins

The G-box (CACGTG) is a ubiquitous, cis-acting DNA regulatory element found in plant genomes. Proteins known as G-box factors (GBFs) bind to G-boxes in a context-specific manner, mediating a wide variety of gene expression patterns. We suggest that as for many biological systems, different combinations of these common elements can lead to diversity and specificity in the regulation of plant gene expression.     

TGA1 and G-box binding factors: two distinct classes of Arabidopsis leucine zipper proteins compete for the G-box-like element TGACGTGG.

Regulatory elements containing the sequence ACGT are found in several plant promoters and are recognized by various basic/leucine zipper (bZIP) proteins. The Arabidopsis G-box binding factor 1 (GBF1), initially identified by its ability to bind to the palindromic G-box (CCACGTGG), also interacts with the TGACGT motif if this hexamer sequence is followed by either the dinucleotide GG--as found in the Hex motif of the wheat histone 3 promoter--or GT. Here we describe the isolation of an Arabidopsis bZIP protein, denoted TGA1, that also recognizes ACGT-containing sequences. However, TGA1 differs from members of the GBF family in the spectrum of base pair permutations flanking the ACGT sequence that are required for DNA binding. TGA1 primarily requires a TGACG motif and preferentially binds to those pentamers that are followed by a T residue. We show that although both TGA1 and GBF1 bind to the Hex motif (TGACGTGG), this binding can be distinguished on the basis of their specific DNA-protein contacts. Furthermore, TGA1 also differs from members of the GBF family in that it apparently does not form heterodimers with any member of this family.     

A G-box motif (GCCACGTGCC) tetramer confers high-level constitutive expression in dicot and monocot plants

GUS reporter expression from 11 basal promoters (CaMV –90) with G-box cores (CACGTG) was analysed to evaluate the regulatory roles of G-box flanking sequences. While most G-box motifs exhibited some tissue preference of gene expression, a distinct tissue-specific expression was not apparent. However, one of 11 G-box sequences, the G-box 10 (GCCACGTGCC) tetramer, conferred a high-level constitutive expression in seed, root, leaf, axillary bud, almost all parts of flower buds and pollen of transgenic tobacco plants. Furthermore, the G-box 10 tetramer promoter exhibited high-level expression in transgenic dicot carrot and monocot rice. This is apparently the first report of a G-box motif conferring a high-level constitutive expression in a non-tissue-specific manner.     

Four distinct nuclear proteins recognize in vitro the proximal promoter of the bean seed storage protein β-phaseolin gene conferring spatial and temporal control

A proximal promoter (-422/-13) of the bean seed storage protein beta-phaseolin gene contains cis-regulatory elements conferring spatial and temporal gene regulation. To correlate trans-acting elements with these cis-elements, we performed gel mobility shift and exonuclease III protection assays using bean seed nuclear proteins, and identified target sequences of four DNA-binding proteins associated with this promoter. Three CANNTG motifs, CACGTG (-248/-243), CACCTG (-163/-158), and CATATG (-100/-95), were determined as target sequences of the same DNA-binding protein designated CAN. Competition assays using oligonucleotides containing the wild-type or mutated CANNTG motif indicated that the CANNTG motif appears to be a preferred target sequence for CAN binding. Competition assays also demonstrated that DNA-binding protein AG-1 binds to AAAAAG(A/G)CAA (-356/-347, -191/-182), CA-1 binds to two CA-rich sequences (-201/-192, -175/-160), and that a TATA-box binding protein binds to either TATATAA (-43/-37) or TATAAA (-32/-27) or both. Based on these and other results, it is proposed that CACGTG motif (-248/-243) is a major cis-acting regulatory element conferring spatial and temporal control of the beta-phaseolin gene.     

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

The promoters of wheat, barley and wild oat -Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X_4–5-C-X_22–23-H-X₁-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.