Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Purification of cytochromes P-450(scc) and P-450(17 alpha) by steroid-binding affinity column chromatography.

The preparation, testing and use of a variety of cholesterol-, deoxycorticosterone (DOC)- and pregnenolone-binding 1,6-diaminohexyl (EAH)-Sepharose 4B supports for affinity column chromatography of cytochromes P-450(scc) and P-450(17 alpha) from bovine adrenal and pig testis are described. EAH-Sepharose 4B has free amino groups at the end of a 10-atom spacer arm. Hydroxyl groups of cholesterol (3 beta), deoxycorticosterone (21 beta) and pregnenolone (3 beta) are linked to succinic anhydride in pyridine through an ester linkage. These coupling ligands of hemisuccinate were synthesized by a general procedure. Free amino groups of EAH-Sepharose 4B were used to couple ligands, containing carboxyl groups, by the carbodiimide coupling method. Both the purified cytochromes P-450(scc) and P-450(17 alpha) were found to be homogeneous and estimated to have a molecular weight of 52,000 on polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The carbon monoxide difference spectra with peaks at 450 and 448 nm exhibit the absorption spectra of typical cytochromes P-450(scc) and P-450(17 alpha), respectively. Cytochromes P-450(scc) and P-450(17 alpha) were determined to have isoelectric points of 8.0 and 6.5 in isoelectric focusing on a pH gradient gel. Cytochrome P-450s can be purified between 425- and 1000-fold from the crude extracts.     

Cytochrome P-450(17 alpha,lyase)-mediating pathway of androgen synthesis in bovine adrenocortical cultured cells.

Cytochrome P-450(17 alpha,lyase) mediating pathway of dehydroepiandrosterone (DHA) formation from pregnenolone was investigated in primary cultures of bovine adrenocortical fasciculata-reticularis cells. To determine whether DHA formation proceeds predominantly by successive monooxygenase reactions without 17 alpha-hydroxypregnenolone leaving P-450(17 alpha,lyase) the cells were incubated with [14C]pregnenolone and 17 alpha-[3H]hydroxypregnenolone in the presence of Trilostane. Results of the double-substrate double-label experiments indicate that in the presence of high concentration of pregnenolone most of DHA was formed, directly from pregnenolone by the successive reactions. Since the concentration of pregnenolone usually exceeds that of 17 alpha-hydroxypregnenolone in the adrenal glands, DHA is concluded to be formed predominantly by successive reactions from pregnenolone without 17 alpha-hydroxypregnenolone leaving P-450(17 alpha,lyase) in vivo. By chronic ACTH treatment, the activities of 17 alpha-hydroxylation and DHA formation in adrenocortical cultured cells became higher concomitantly with the increase of P-450(17 alpha,lyase) content. Most of DHA was found to be formed by successive reactions from pregnenolone even under such conditions.     

Interaction of steroids with adrenal cytochrome P-450 (P-450(17)alpha,lyase) in liposome membranes

Purified cytochrome P-450(17)alpha,lyase from guinea-pig adrenal microsomes, which catalyzes progesterone 17 alpha-hydroxylation and sequentially C17-C20 bond cleavage of the 17 alpha-hydroxyprogesterone, was successfully incorporated into liposomal membranes composed of only phosphatidylcholine or of a phospholipid mixture of phosphatidylcholine, phosphatidylethanolamine and phosphatidylserine at a molar ratio of 5:3:1. Although the purified P-450(17)alpha,lyase was readily converted into P-420 in the detergent-solubilized system without substrates, the P-450 embedded in the liposomal membranes was found to be quite stable without the substrates. Using the P-450(17)alpha,lyase-proteoliposomes, the interaction of steroids with P-450(17)alpha,lyase was studied for progesterone, 17 alpha-hydroxyprogesterone and androstenedione in the liposomal system by optical difference spectroscopy and by equilibrium dialysis. The partition coefficients of steroids between the aqueous phase and the liposomal membranes were determined by the equilibrium dialysis. They were about 1.4-1.6-times higher in phosphatidylcholine liposomes than in the liposomes of the lipid mixture. The dissociation constants of the P-450-steroid complexes were calculated from the apparent dissociation constants using the partition coefficients for the situation where the substrate-binding site faces the lipid phase of the membranes or where it faces the aqueous phase. The dissociation constant in the former case was not affected by the lipid composition. These results suggest that P-450(17)alpha,lyase might interact only with the substrates in the lipid phase of the liposomal membranes.     

Induction of 17 alpha-hydroxylase (cytochrome P-450(17)alpha) activity by adrenocorticotropin in bovine adrenocortical cells maintained in monolayer culture

Using bovine adrenocortical cells in monolayer culture it has been shown that treatment with adrenocorticotropin (ACTH) causes a dramatic increase in 17 alpha-hydroxylase activity. In postmitochondrial supernatant fractions (PMS) prepared from cells maintained in culture, there was a 15-fold increase in 17 alpha-hydroxylase activity 36 h following initiation of ACTH treatment compared with the activity measured in PMS prepared from control cells. In the continued presence of ACTH, 17 alpha-hydroxylase activity declined; however, even after 60 h of exposure to ACTH, 17 alpha-hydroxylase activity was eight times higher than that present in control cells. The dramatic increase in 17 alpha-hydroxylase activity provides an explanation for the previously observed phenomenon that following initiation of ACTH treatment of bovine adrenocortical cells in monolayer culture there is a shift in the pattern of corticosteroid secretion from approximately equal amounts of cortisol and corticosterone to almost exclusively cortisol. Thus, the modulation of 17 alpha-hydroxylase activity by ACTH action appears to serve a key regulatory role in the pattern of corticosteroid production. Soluble cytosolic factors apparently do not participate in the regulation of 17 alpha-hydroxylase activity in the bovine adrenal cortex. Increases in the magnitude of substrate-induced absorbance changes are indicative that the increase in 17 alpha-hydroxylase activity is due, at least in part, to an elevation of cytochrome P-450(17)alpha synthesis.     

Developmental expression of bovine adrenocortical steroid hydroxylases. Regulation of P-450(17 alpha) expression leads to episodic fetal cortisol production

The developmental expression of adrenocortical steroid hydroxylases was studied in bovine fetuses from 40 to 280 days gestational age. The expression of P-450(17 alpha) is first detected at a gestational age of 50 days and reaches a maximum at 60-70 days. The expression of P-450(17 alpha) then declines and is nondetectable at a gestational age of 100 days. P-450(17 alpha) is not expressed again until about 240 days, i.e. shortly before birth (approximately 280 days). P-450scc, P-450c21, P-450(11 beta) and adrenodoxin were present in fetal adrenals throughout gestation. This "on-off-on" pattern of P-450(17 alpha) expression during fetal development was associated with a corresponding episodic production of cortisol. Immunoreactive corticotropin (ACTH) levels in fetal plasma were elevated in small fetuses (corresponding to less than or equal to 100 days) and in near-term fetuses (corresponding to greater than 250 days) compared with those in mid-gestation fetuses. In primary culture, adrenal cells from mid-gestation fetuses contained no detectable P-450(17 alpha) but rapidly responded to ACTH with an increase in P-450(17 alpha) protein and mRNA. The tissue specificity of the developmental patterns is emphasized by the fact that both P-450(17 alpha) and P-450scc were detectable throughout the development of the fetal testes, whereas only P-450scc was detectable in fetal bovine ovary prior to 200 days. Thus, in fetal bovine adrenal it appears that ACTH is the major regulatory factor effecting the intermittent presence of P-450(17 alpha), whereas the presence of the other steroid hydroxylases is either regulated by additional factors or shows a much different sensitivity to ACTH.     

The interference of polychlorinated biphenyls (Aroclor 1254) with membrane regulation of the activities of cytochromes P-450C21 and P-450(17) alpha,lyase in guinea-pig adrenal microsomes.

Regulation of cytochromes P-450 21-hydroxylase (P-450C21) and P-450 17 alpha-hydroxylase/C17,20-lyase (P-450(17) alpha,lyase) activities and impairment of this regulation by Aroclor 1254 was studied in guinea-pig adrenal microsomes. In a membrane depleted system, a decrease in the normally predominant, P-450C21 activity and an increase in P-450(17) alpha,lyase activities was observed. The same deviations were observed in intact microsomes with increase in the reaction temperature (0-40 degrees C). Breaks in Arrhenius plots for activities of P-450C21 and P-450(17) alpha,lyase correlate with transition temperatures reported for the microsomal membrane. These results point to: (1) preference of a gel state membrane for catalytic expression of P-450C21 suggesting a clustered organization of this P-450 species with reductase; (2) preference of a fluid membrane for lyase activity suggesting a random collision mechanism for reduction of P-450(17) alpha,lyase. Aroclor 1254 introduced to reaction mixtures containing intact microsomes elicited basically the same changes as caused by depletion of the microsomal membrane or by increase in the incubation temperature. Lack of effect of Aroclor 1254 on P-450C21 and P-450(17) alpha,lyase activities in the membrane depleted system demonstrates that its interference with monooxygenase activities is mediated by the microsomal membrane. The similarities between altered cytochrome P-450 mediated activities in the presence of Aroclor 1254 and the deviations observed in the membrane depleted system or upon increase in the incubation temperature may suggest that this chemical exerts its impacts by influencing membrane fluidity.