Probing high affinity sequences of DNA aptamer against VEGF165

Vascular endothelial growth factor (VEGF(165)) is a potent angiogenic mitogen commonly overexpressed in cancerous cells. It contains two main binding domains, the receptor-binding domain (RBD) and the heparin-binding domain (HBD). This study attempted to identify the specific sequences of the VEa5 DNA aptamer that exhibit high binding affinity towards the VEGF(165) protein by truncating the original VEa5 aptamer into different segments. Using surface plasmon resonance (SPR) spectroscopy for binding affinity analysis, one of the truncated aptamers showed a >200-fold increase in the binding affinity for HBD. This truncated aptamer also exhibited high specificity to HBD with negligible binding affinity for VEGF(121), an isoform of VEGF lacking HBD. Exposing colorectal cancer cells to the truncated aptamer sequence further confirmed the binding affinity and specificity of the aptamer to the target VEGF(165) protein. Hence, our approach of aptamer truncation can potentially be useful in identifying high affinity aptamer sequences for the biological molecules and targeting them as antagonist for cancer cell detection.     

Imino proton exchange rates imply an induced-fit binding mechanism for the VEGF165-targeting aptamer, Macugen

The 2'-fluoro/2'-O-methyl modified RNA aptamer Macugen is a potent inhibitor of the angiogenic regulatory protein, VEGF165. Macugen binds with high affinity to the heparin-binding domain (HBD) of VEGF165. Hydrogen exchange rates of the imino protons were measured for free Macugen and Macugen bound to the HBD or full-length VEGF to better understand the mechanism for high affinity binding. The results here show that the internal loop and hairpin loop of Macugen are highly dynamic in the free state and are greatly stabilized and/or protected from solvent upon protein binding.     

Investigation of the interaction between split aptamer and vascular endothelial growth factor 165 using single molecule force spectroscopy

Understanding the binding of split aptamer/its target could become a breakthrough in the application of split aptamer. Herein, vascular endothelial growth factor (VEGF), a major biomarker of human diseases, was used as a model, and its interaction with split aptamer was explored with single molecule force spectroscopy (SMFS). SMFS demonstrated that the interaction force of split aptamer/VEGF₁₆₅ was 169.44 ± 6.59 pN at the loading rate of 35.2 nN/s, and the binding probability of split aptamer/VEGF₁₆₅ was dependent on the concentration of VEGF₁₆₅. On the basis of dynamic force spectroscopy results, one activation barrier in the dissociation process of split aptamer/VEGF₁₆₅ complexes was revealed, which was similar to that of the intact aptamer/VEGF₁₆₅. Besides, the dissociation rate constant (k_off) of split aptamer/VEGF₁₆₅ was close to that of intact aptamer/VEGF₁₆₅, and the interaction force of split aptamer/VEGF₁₆₅ was higher than the force of intact aptamer/VEGF₁₆₅. It indicated that split aptamer also possessed high affinity with VEGF₁₆₅. The work can provide a new method for exploring the interaction of split aptamer/its targets at single‐molecule level.     

Overexpression of VEGF189 in breast cancer cells induces apoptosis via NRP1 under stress conditions

The existence of multiple VEGF-A isoforms raised the possibility that they may have distinct functions in tumor growth. We have previously published that VEGF189 and VEGF165 contribute to breast cancer progression and angiogenesis, but VEGF165 induced the most rapid tumor uptake. Since VEGF165 has been described as a survival factor for breast tumor cells, we questioned here the effects of VEGF189 on the survival/apoptosis of MDA-MB-231 cells. We used clones that overexpress VEGF189 (V189) or VEGF165 (V165) isoforms and compared them to a control one (cV). Overexpression of VEGF189 resulted in increased cell apoptosis, as determined by Annexin-V apoptosis assay, under serum starvation and doxorubicin treatment, while VEGF 165 was confirmed to be a survival factor. Since MDA-MB-231 highly express NRP1 (a co-receptor for VEGF-A), we used short hairpin RNA (shRNA) to knock down NRP1 expression. V189shNRP1 clones were characterized by reduced apoptosis and higher necrosis, as compared with V189shCtl, under stress conditions. Unexpectedly, NRP1 knockdown had no effect on the survival or apoptosis of V165 cells. VEGF189 showed greater affinity toward NRP1 than VEGF165 using a BIAcore binding assay. Finally, since endogenously produced urokinase-type plasminogen (uPA) has been found to prevent apoptosis in breast cancers, we analyzed the level of uPA activity in our clones. An inhibition of uPA activity was observed in V189shNRP1 clones. Altogether, these results suggest a major role of NRP1 in apoptosis induced by VEGF189 in stress conditions and confirm VEGF165 as a survival factor.Key words: VEGF isoforms, survival, apoptosis, NRP-1, breast cancer cells     

Overexpression of VEGF189 in breast cancer cells induces apoptosis via NRP1 under stress conditions

The existence of multiple VEGF-A isoforms raised the possibility that they may have distinct functions in tumor growth. We have previously published that VEGF189 and VEGF165 contribute to breast cancer progression and angiogenesis, but VEGF165 induced the most rapid tumor uptake. Since VEGF165 has been described as a survival factor for breast tumor cells, we questioned here the effects of VEGF189 on the survival/apoptosis of MDA-MB-231 cells. We used clones which overexpress VEGF189 (V189) or VEGF165 (V165) isoforms and compared them to a control one (cV). Overexpression of VEGF189 resulted in increased cell apoptosis, as determined by Annexin-V apoptosis assay, under serum starvation and doxorubicin treatment, while VEGF 165 was confirmed to be a survival factor. Since MDA-MB-231 highly express NRP1 (a co-receptor for VEGF-A), we used short hairpin RNA (shRNA) to knockdown NRP1 expression. V189shNRP1 clones were characterized by reduced apoptosis and higher necrosis, as compared to V189shCtl, under stress conditions. Unexpectedly, NRP1 knock-down had no effect on the survival or apoptosis of V165 cells. VEGF189 showed greater affinity towards NRP1 than VEGF165 using a BIAcore binding assay. Finally, since endogenously produced urokinase-type plasminogen (uPA) has been found to prevent apoptosis in breast cancers, we analyzed the level of uPA activity in our clones. An inhibition of uPA activity was observed in V189shNRP1 clones. Altogether, these results suggest a major role of NRP1 in apoptosis induced by VEGF189 in stress conditions and confirm VEGF165 as a survival factor.     

A "signal-on" electrochemical aptasensor for simultaneous detection of two tumor markers

In this paper, we report a "signal-on" electrochemical aptasensor for simultaneous determination of two tumor markers MUC1 and VEGF(165), by using a ferrocene-labeled aptamer-complementary DNA (cDNA) as probe. Since the cDNA immobilized on an electrode surface can hybridize with both MUC1 aptamer and VEGF(165) aptamer to form a long double strand with ferrocene far away from the electrode surface, the probe cannot give electrochemical signal. Nevertheless, the presence of the two tumor markers will inhibit the hybridization of cDNA with the aptamers, thus the distance between ferrocene and the electrode is changed, and a "signal-on" electrochemical method to detect two tumor markers is developed. Experimental results show that the electrochemical signal increases with the addition of either tumor markers, but the biggest electrochemical signal can only be obtained when both tumor markers are present. Therefore, the proposed electrochemical aptasensor can not only detect the two markers but also distinguish their co-existence. It may also display high selectivity and sensitivity towards the detection of the tumor markers, so it might have potential clinical application in the future.     

Enhancement of angiogenic effect of co-transfection human NGF and VEGF genes in rat bone marrow mesenchymal stem cells

The current study explored the feasibility and efficacy of co-transfection of the human nerve growth factor (NGF) and vascular endothelial growth factor 165 (VEGF165) genes in rat bone marrow mesenchymal stem cells (BMSCs). The obtained hNGF and vascular endothelial growth factor (VEGF) cDNAs were cloned into the pEGFP-C1 expression vector to construct the recombinant vectors. Co-transfection in rat BMSCs was performed and the expressions of both genes were detected by RT-PCR, Western blot, and enzyme-linked immunospecific assay. The biological activity of recombinant NGF and VEGF proteins was confirmed using the Chick Chorioallantoic Membrane (CAM) assay. NGF and VEGF genes could be expressed successfully in rat BMSCs. The recombinant NGF and VEGF from the rat BMSCs showed a more significant synergetic biological activity compared with single recombinant NGF or VEGF. These findings demonstrate that the co-transfection of hNGF + VEGF genes can enhance the angiogenic effect in vivo.     

Intrauterine hypertension decreases lung VEGF expression and VEGF inhibition causes pulmonary hypertension in the ovine fetus

Although vascular endothelial growth factor (VEGF) plays a vital role in lung vascular growth in the embryo, its role in maintaining endothelial function and modulating vascular structure during late fetal life has not been studied. We hypothesized that impaired lung VEGF signaling causes pulmonary hypertension, endothelial dysfunction, and structural remodeling before birth. To determine whether lung VEGF expression is decreased in an experimental model of persistent pulmonary hypertension of the newborn (PPHN), we measured lung VEGF and VEGF receptor protein content from fetal lambs 7-10 days after ductus arteriosus ligation (132-140 days gestation; term = 147 days). In contrast with the surge in lung VEGF expression during late gestation in controls, chronic intrauterine pulmonary hypertension reduced lung VEGF expression by 78%. To determine whether VEGF inhibition during late gestation causes pulmonary hypertension, we treated fetal lambs with EYE001, an aptamer that specifically inhibits VEGF(165). Compared with vehicle controls, EYE001 treatment elevated pulmonary artery pressure and pulmonary vascular resistance by 22 and 50%, respectively, caused right ventricular hypertrophy, and increased wall thickness of small pulmonary arteries. EYE001 treatment reduced lung endothelial nitric oxide synthase protein content by 50% and preferentially impaired the pulmonary vasodilator response to ACh, an endothelium-dependent agent. We conclude that chronic intrauterine pulmonary hypertension markedly decreases lung VEGF expression and that selective inhibition of VEGF(165) mimics the structural and physiological changes of experimental PPHN. We speculate that hypertension downregulates VEGF expression in the developing lung and that impaired VEGF signaling may contribute to the pathogenesis of PPHN.     

VEGF165-binding sites within heparan sulfate encompass two highly sulfated domains and can be liberated by K5 lyase

The vascular endothelial growth factor (VEGF) family of proteins controls the formation and growth of blood vessels. The most potent and widely expressed isoform, VEGF165, is secreted as a disulfide-linked homodimer with two identical heparin-binding sites. Interactions with heparan sulfate (HS) regulate the diffusion, half-life, and affinity of VEGF165 for its signaling receptors. We have determined a number of key HS structural features that mediate the specific binding of the VEGF165 dimer. Carboxylate groups and 2-O-, 6-O-, and N-sulfation of HS contributed to the strength of the VEGF165 interaction; however, 6-O-sulfates appeared to be particularly important. Cleavage of HS by heparinase, heparitinase, or heparanase severely reduced VEGF165 binding. In contrast, K5 lyase-cleaved HS retained significant VEGF165 affinity, suggesting that binding sites for the growth factor are present within extended stretches of sulfation. Binding studies and molecular modeling demonstrated that an oligosaccharide 6 or 7 residues long was sufficient to fully occupy the heparin-binding site of a VEGF165 monomer. The data presented are consistent with a model whereby the two heparin-binding sites of the VEGF165 dimer interact simultaneously with highly sulfated S-domain regions of the HS chain that can be linked through a stretch of transition sequence.     

Aptamer Selection Based on G4-Forming Promoter Region

We developed a method for aptamer identification without in vitro selection. We have previously obtained several aptamers, which may fold into the G-quadruplex (G4) structure, against target proteins; therefore, we hypothesized that the G4 structure would be an excellent scaffold for aptamers to recognize the target protein. Moreover, the G4-forming sequence contained in the promoter region of insulin can reportedly bind to insulin. We thus expected that G4 DNAs, which are contained in promoter regions, could act as DNA aptamers against their gene products. We designated this aptamer identification method as “G4 promoter-derived aptamer selection (G4PAS).” Using G4PAS, we identified vascular endothelial growth factor (VEGF)165, platelet-derived growth factor-AA (PDGF)-AA, and RB1 DNA aptamers. Surface plasmon resonance (SPR) analysis revealed that the dissociation constant (K _d) values of VEGF165, PDGF-AA, and RB1 DNA aptamers were 1.7 × 10⁻⁷ M, 6.3 × 10⁻⁹ M, and 4.4 × 10⁻⁷ M, respectively. G4PAS is a simple and rapid method of aptamer identification because it involves only binding analysis of G4 DNAs to the target protein. In the human genome, over 40% of promoters contain one or more potential G4 DNAs. G4PAS could therefore be applied to identify aptamers against target proteins that contain G4 DNAs on their promoters.     

Glypican-1 is a VEGF165 binding proteoglycan that acts as an extracellular chaperone for VEGF165

Glypican-1 is a member of a family of glycosylphosphatidylinositol anchored cell surface heparan sulfate proteoglycans implicated in the control of cellular growth and differentiation. The 165-amino acid form of vascular endothelial growth factor (VEGF165) is a mitogen for endothelial cells and a potent angiogenic factor in vivo. Heparin binds to VEGF165 and enhances its binding to VEGF receptors. However, native HSPGs that bind VEGF165 and modulate its receptor binding have not been identified. Among the glypicans, glypican-1 is the only member that is expressed in the vascular system. We have therefore examined whether glypican-1 can interact with VEGF165. Glypican-1 from rat myoblasts binds specifically to VEGF165 but not to VEGF121. The binding has an apparent dissociation constant of 3 x 10(-10) M. The binding of glypican-1 to VEGF165 is mediated by the heparan sulfate chains of glypican-1, because heparinase treatment abolishes this interaction. Only an excess of heparin or heparan sulfates but not other types of glycosaminoglycans inhibited this interaction. VEGF165 interacts specifically not only with rat myoblast glypican-1 but also with human endothelial cell-derived glypican-1. The binding of 125I-VEGF165 to heparinase-treated human vascular endothelial cells is reduced following heparinase treatment, and addition of glypican-1 restores the binding. Glypican-1 also potentiates the binding of 125I-VEGF165 to a soluble extracellular domain of the VEGF receptor KDR/flk-1. Furthermore, we show that glypican-1 acts as an extracellular chaperone that can restore the receptor binding ability of VEGF165, which has been damaged by oxidation. Taken together, these results suggest that glypican-1 may play an important role in the control of angiogenesis by regulating the activity of VEGF165, a regulation that may be critical under conditions such as wound repair, in which oxidizing agents that can impair the activity of VEGF are produced, and in situations were the concentrations of active VEGF are limiting.     

Matrix metalloproteinases cleave connective tissue growth factor and reactivate angiogenic activity of vascular endothelial growth factor 165

Vascular endothelial growth factor (VEGF), a potent angiogenic mitogen, plays a crucial role in angiogenesis under various pathophysiological conditions. We have recently demonstrated that VEGF(165), one of the VEGF isoforms, binds connective tissue growth factor (CTGF) and that its angiogenic activity is inhibited in the VEGF(165).CTGF complex form (Inoki, I., Shiomi, T., Hashimoto, G., Enomoto, H., Nakamura, H., Makino, K., Ikeda, E., Takata, S., Kobayashi, K. and Okada, Y. (2002) FASEB J. 16, 219-221). In the present study, we further examined the susceptibility of the VEGF(165).CTGF complex to matrix metalloproteinases (MMP-1, -2, -3, -7, -9, and -13), ADAMTS4 (aggrecanase-1), and serine proteinases, and evaluated the recovery of the angiogenic activity of VEGF(165) after the treatment. Among the MMPs, MMP-1, -3, -7, and -13 processed CTGF of the complex into the major NH(2)- and COOH-terminal fragments, whereas VEGF(165) was completely resistant to the MMPs. On the other hand, elastase and plasmin cleaved both CTGF and VEGF(165) of the complex, but they were completely resistant to ADAMTS4. By digestion of the immobilized VEGF(165).CTGF complex with MMP-3 or MMP-7, both NH(2)- and COOH-terminal fragments of CTGF were dissociated and released from the complex into the liquid phase. The in vitro angiogenic activity of VEGF(165) blocked in the VEGF(165).CTGF complex was reactivated to original levels after CTGF digestion of the complex with MMP-1, -3, and -13. Recovery of angiogenic activity was further confirmed by in vivo angiogenesis assay using a Matrigel injection model in mice. These results demonstrate for the first time that CTGF is a substrate of MMPs and that the angiogenic activity of VEGF(165) suppressed by the complex formation with CTGF is recovered through the selective degradation of CTGF by MMPs. MMPs may play a novel role through CTGF degradation in VEGF-induced angiogenesis during embryonic development, tissue maintenance, and/or pathological processes of various diseases.     

Generation of a novel proteolysis resistant vascular endothelial growth factor165 variant by a site-directed mutation at the plasmin sensitive cleavage site

Vascular endothelial growth factor (VEGF) is a potent angiogenic mediator in tissue repair. In non-healing human wounds plasmin cleaves and inactivates VEGF165. In the present study, we generated recombinant VEGF165 mutants resistant to plasmin proteolysis. Substitution of Arg110 with Ala110 or Gln110, and Ala111 with Pro111 yielded plasmin-resistant and biologically active VEGF165 mutants. In addition, substitution of Ala111 with Pro111 resulted in a substantial degree of stabilization when incubated in wound fluid obtained from non-healing wounds. These results suggest that the plasmin cleavage site Arg110/Ala111 and the carboxyl-terminal domain play an important role in the mitogenic activity of VEGF165.     

Structural features in heparin that interact with VEGF165 and modulate its biological activity.

The 165 amino acid form of vascular endothelial growth factor (VEGF165) is a heparin-binding growth factor with mitogenic activity for vascular endothelial cells. We examined activities of various heparin derivatives toward their interactions with VEGF165 using an enzyme-linked immunosorbent assay and elucidated the structural features in heparin for the interactions. Native heparin interacted with VEGF165, whereas N-desulfated, N-acetylated (N-DS, N-Ac-) heparin, and 6-O-desulfated (6-O-DS-) heparin did not. The 2-O-desulfated (2-O-DS-) heparin retained the ability for the interaction with VEGF165. In contrast, the 2-O-DS-heparin exhibited no ability for the interaction with FGF-2 and HGF. Thus, structural requirements in heparin for the specific interaction with VEGF165 are distinct from those with FGF-2 and HGF which require a high content of 2-O-sulfate groups. In a cell proliferation assay, native heparin and 2-O-DS-heparin exhibited inhibitory abilities for VEGF165-induced proliferation of human umbilical vein endothelial cells (HUVECs) with their high concentrations (more than 64 microg/ml), while only native heparin could enhance the proliferation of the chlorate-treated cells. These results suggested that a high content of 2-O-sulfate groups is not required for the specific interaction with VEGF165alone, although it is essential for the mitogenic activity of the growth factor.     

Semaphorin-3A and semaphorin-3F work together to repel endothelial cells and to inhibit their survival by induction of apoptosis

Semaphorin-3A (sema3A) is a neuropilin-1 (np1) agonist. It inhibits the binding of the 165-amino acid form of VEGF (VEGF(165)) to np1 and was reported to inhibit angiogenesis as a result. However, we find that sema3A concentrations that inhibit the mitogenic effects of VEGF(165) do not inhibit VEGF(165)-induced phosphorylation of VEGF receptor-2 (VEGFR-2). Furthermore, sema3A inhibits the biological effects of VEGF(121), a VEGF form that does not bind to neuropilins and basic fibroblast growth factor, a growth factor whose activity, unlike that of VEGF, is not inhibited by small interfering RNA directed against np1. Therefore, the mechanism by which sema3A inhibits VEGF(165) activity does not depend on competition with VEGF(165) for binding to np1. Sema3A induced rapid disappearance of focal contacts followed by collapse of the actin cytoskeleton in human umbilical vein-derived endothelial cells. HEK293 cells expressing sema3A repel human endothelial cells and at high concentrations induce their death by apoptosis. Furthermore, sema3A inhibited the formation of tubes from endothelial cells in an in vitro angiogenesis assay. Similar effects are induced by the neuropilin-2 (np2) agonist sema3F. These inhibitory effects are abrogated by small interfering RNAs directed against np1 or np2, respectively. The anti-proliferative effects of sema3A and sema3F are additive when the semaphorins are added as pure proteins. However, when sema3A and sema3F were co-expressed in HEK293 cells their pro-apoptotic and cell repellant activities appeared to be synergistic. These observations suggest that combinations of sema3A and sema3F may be able to inhibit tumor angiogenesis more effectively than single semaphorins.     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications

A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G–C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF₁₆₅ unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF₁₆₅ RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF₁₆₅. Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF₁₆₅ and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF₁₆₅ DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF₁₆₅.     

Expression and characterization of human vascular endothelial growth factor (VEGF165) in insect cells

Vascular endothelial growth factor (VEGF) is the best characterized multifunctional protein which plays a key role in normal and pathologic angiogenesis. The gene encoding the human VEGF165 was cloned from the ovarian carcinoma cell line (OVCAR3) and expressed in insect cells using the baculovirus expression vector system. The recombinant human VEGF165 (rhVEGF165) protein produced by Sf21 (Spodoptera frugiperda) cells underwent a similar processing compared with mammalian cells, including efficient glycosylation, formation of a disulfide-linked dimer and secretion into the media. The rhVEGF165 had a high affinity for heparin and this characteristic was used to purify this form to homogeneity by heparin affinity, Resource S and Resource RPC columns. The biological activity of the purified 42-kDa homodimer was shown by the induction of the proliferation of human umbilical vein derived endothelial cells. These results demonstrate that an angiogenic growth factor whose normal processing requires glycosylation and disulfide-bridge formation can be efficiently expressed in high concentration (up to 20mg/L) in Sf21 cells.