Can SINEs: a family of tRNA-derived retroposons specific to the superfamily Canoidea.

A repetitive element of approximately 200 bp was cloned from harbour seal (Phoca vitulina concolour) genomic DNA. The sequence of the element revealed putative RNA polymerase III control boxes, a poly A tail and direct terminal repeats characteristic of SINEs. Sequence and secondary structural similarities suggest that the SINE is derived from a tRNA, possibly tRNA-alanine. Southern blot analysis indicated that the element is predominately dispersed in unique regions of the seal genome, but may also be present in other repetitive sequences, such as tandemly arrayed satellite DNA. Based on slot-blot hybridization analysis, we estimate that 1.3 x 10(6) copies of the SINE are present in the harbour seal genome; SINE copy number based on the number of clones isolated from a size-selected library, however, is an order of magnitude lower (1-3 x 10(5) copies), an estimate consistent with the abundance of SINEs in other mammalian genomes. Database searches found similar sequences have been isolated from dog (Canis familiaris) and mink (Mustela vison). These, and the seal SINE sequences are characterized by an internal CT dinucleotide microsatellite in the tRNA-unrelated region. Hybridization of genomic DNA from representative species of a wide range of mammalian orders to an oligonucleotide (30mer) probe complementary to a conserved region of the SINE confirmed that the element is unique to carnivores of the superfamily Canoidea.     

G-repeats: a novel hamster sine family.

A fragment of a hamster repetitive element inserted into the aprt locus of a radiation-induced mutant is a member of a novel interspersed repetitive (SINE) family constituting approximately 0.3 to 0.5% of the hamster genome (30 to 50,000 family members). Since this family was first detected in a gene rearranged after exposure to gamma irradiation, we have called these G-repeats. In common with other repetitive elements, members of this family are about 300 bp in length, are highly divergent (an average of 30% from the consensus), have an A + T rich sequence flanking one side, and can be found in short polydisperse circular (SPC) DNA. In contrast to some other families, G-repeats are not flanked by short direct repeats and lack sequences corresponding to the RNA polymerase III consensus promoter.     

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.     

Isolation of polymorphic AGC repeats located 3' to bovine SINEs

A bovine genomic library was screened for the presence of (AGC)n repeats. All isolated AGC repeats were located adjacent to the 3′ end of bovine short interspersed nuclear elements (SINE). Polymerase chain reactions (PCR) using either two unique primers or one unique and one SINE primer produced high-resolution products without the secondary artifact ladders typical of dinucleotide microsatellites. Four AGC microsatellites were found to be polymorphic with 2–4 alleles each and polymorphism information context (PIC) values ranging between 0.26 and 0.49. One microsatellite, AR025, was mapped to chromosome 26 with the CSIRO reference families. Because of their strong association with AGC repeats and high frequency in the genome, SINE-3′ PCR may prove to be a novel source of polymorphic trinucleotide markers in the bovine genome.     

Characterizing the walnut genome through analyses of BAC end sequences

Persian walnut (Juglans regia L.) is an economically important tree for its nut crop and timber. To gain insight into the structure and evolution of the walnut genome, we constructed two bacterial artificial chromosome (BAC) libraries, containing a total of 129,024 clones, from in vitro-grown shoots of J. regia cv. Chandler using the HindIII and MboI cloning sites. A total of 48,218 high-quality BAC end sequences (BESs) were generated, with an accumulated sequence length of 31.2?Mb, representing approximately 5.1% of the walnut genome. Analysis of repeat DNA content in BESs revealed that approximately 15.42% of the genome consists of known repetitive DNA, while walnut-unique repetitive DNA identified in this study constitutes 13.5% of the genome. Among the walnut-unique repetitive DNA, Julia SINE and JrTRIM elements represent the first identified walnut short interspersed element (SINE) and terminal-repeat retrotransposon in miniature (TRIM) element, respectively; both types of elements are abundant in the genome. As in other species, these SINEs and TRIM elements could be exploited for developing repeat DNA-based molecular markers in walnut. Simple sequence repeats (SSR) from BESs were analyzed and found to be more abundant in BESs than in expressed sequence tags. The density of SSR in the walnut genome analyzed was also slightly higher than that in poplar and papaya. Sequence analysis of BESs indicated that approximately 11.5% of the walnut genome represents a coding sequence. This study is an initial characterization of the walnut genome and provides the largest genomic resource currently available; as such, it will be a valuable tool in studies aimed at genetically improving walnut.     

A new family of widely propagated MB1-repeats in the human genome

A new family of repeats--i.e. MB1 repeats family--the number of copies of which per a human genome constitutes a few hundreds of thousands of copies has been revealed in a human gemone by computer analysis of a noncanonical similarity of nucleic acid sequences. The numbers of that family of repeats have also been revealed in the genomes of mouse and rat, they have been identified as mirror--reflected copies--in purines and pyrimidines--of B1 repeats in the genome of mouse and the Alu repeats in the human genome. The MB1 repeats tend to remain most similar at a length of 70 b.p. They are not flanked by short repeats, neither contain poly(A) region at the 3' end, by which they differ from the repeats of the SINE family. It has been assumed that the member of the Alu repeats family and the MB1 repeats family can form a so called H-form of DNA. The mirror-reflected repeat family could have been formed by replication of parallel DNA strands.     

Comparative evolution history of SINEs in Arabidopsis thaliana and Brassica oleracea: evidence for a high rate of SINE loss

Brassica oleracea and Arabidopsis thaliana belong to the Brassicaceae(Cruciferae) family and diverged 16 to 19 million years ago. Although the genome size of B. oleracea (approximately 600 million base pairs) is more than four times that of A. thaliana (approximately 130 million base pairs), their gene content is believed to be very similar with more than 85% sequence identity in the coding region. Therefore, this important difference in genome size is likely to reflect a different rate of non-coding DNA accumulation. Transposable elements (TEs) constitute a major fraction of non-coding DNA in plant species. A different rate in TE accumulation between two closely related species can result in significant genome size variations in a short evolutionary period. Short interspersed elements (SINEs) are non-autonomous retroposons that have invaded the genome of most eukaryote species. Several SINE families are present in B. oleracea and A. thaliana and we found that two of them (called RathE1 and RathE2) are present in both species. In this study, the tempo of evolution of RathE1 and RathE2 SINE families in both species was compared. We observed that most B. oleracea RathE2 SINEs are "young" (close to the consensus sequence) and abundant while elements from this family are more degenerated and much less abundant in A. thaliana. However, the situation is different for the RathE1 SINE family for which the youngest elements are found in A. thaliana. Surprisingly, no SINE was found to occupy the same (orthologous) genomic locus in both species suggesting that either these SINE families were not amplified at a significant rate in the common ancestor of the two species or that older elements were lost and only the recent (lineage-specific) insertions remain. To test this latter hypothesis, loci containing a recently inserted SINE in the A. thaliana col-0 ecotype were selected and characterized in several other A. thaliana ecotypes. In addition to the expected SINE containing allele and the pre-integrative allele (i.e. the "empty" allele), we observed in the different ecotypes, alleles with truncated portions of the SINE (up to the complete loss of the element) and of the immediate genomic flanking sequences. The absence of SINEs in orthologous positions between B. oleracea and A. thaliana and the presence in recently diverged A. thaliana ecotypes of alleles containing severely truncated SINEs suggest a very high rate of SINE loss in these species.     

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.     

Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family‐specific impact on gene structure and genome organization

Short interspersed nuclear elements (SINEs) are highly abundant non‐autonomous retrotransposons that are widespread in plants. They are short in size, non‐coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem‐like duplications and transduction of adjacent sequence regions.     

MyrSINEs: a novel SINE family in the anteater genomes

Recent rapid generation of genomic sequence data has allowed many researchers to perform comparative analyses in various mammalian species. However, characterization of transposable elements, such as short interspersed repetitive elements (SINEs), has not been reported for several mammalian groups. Because SINEs occupy a large portion of the mammalian genome, they are believed to have contributed to the constitution and diversification of the host genomes during evolution. In the present study, we characterized a novel SINE family in the anteater genomes and designated it the MyrSINE family. Typical SINEs consist of a tRNA-related, a tRNA-unrelated and an AT-rich (or poly-A) region. MyrSINEs have only tRNA-related and poly-A regions; they are included in a group called t-SINE. The tRNA-related regions of the MyrSINEs were found to be derived from tRNA^Gly. We demonstrate that the MyrSINE family can be classified into three subfamilies. Two of the MyrSINE subfamilies are distributed in the genomes of both giant anteater and tamandua, while the other is present only in the giant anteater. We discuss the evolutionary history of MyrSINEs and their relationship to the evolution of anteaters. We also speculate that the simple structure of t-SINEs may be a potential evolutionary source for the generation of the typical SINE structure.     

Evolutionary implications of multiple SINE insertions in an intronic region from diverse mammals

An analysis of the nuclear β-fibrinogen intron 7 locus from 30 taxa representing 12 placental orders of mammals reveals the enriched occurrences of short interspersed element (SINE) insertion events. Mammalian-wide interspersed repeats (MIRs) are present at orthologous sites of all examined species except those in the order Rodentia. The higher substitution rate in mouse and a rare MIR deletion from rat account for the absence of MIR in the rodents. A minimum of five lineage-specific SINE sequences are also found to have independently inserted into this intron in Carnivora, Artiodactyla and Lagomorpha. In the case of Carnivora, the unique amplification pattern of order-specific CAN SINE provides important evidence for the “pan-carnivore” hypothesis of this repeat element and reveals that the CAN SINE family may still be active today. Particularly interesting is the finding that all identified lineage-specific SINE elements show a strong tendency to insert within or in very close proximity to the preexisting MIRs for their efficient integrations, suggesting that the MIR element is a hot spot for successive insertions of other SINEs. The unexpected MIR excision as a result of a random deletion in the rat intron locus and the non-random site targeting detected by this study indicate that SINEs actually have a greater insertional flexibility and regional specificity than had previously been recognized. Implications for SINE sequence evolution upon and following integration, as well as the fascinating interactions between retroposons and the host genomes are discussed.     

Wide distribution of short interspersed elements among eukaryotic genomes.

Most short interspersed elements (SINEs) in eukaryotic genomes originate from tRNA and have internal promoters for RNA polymerase III. The promoter contains two boxes (A and B) spaced by approximately 33 bp. We used oligonucleotide primers specific to these boxes to detect SINEs in the genomic DNA by polymerase chain reaction (PCR). Appropriate DNA fragments were revealed by PCR in 30 out of 35 eukaryotic species suggesting the wide distribution of SINEs. The PCR products were used for hybridization screening of genomic libraries which resulted in identification of four novel SINE families. The application of this approach is illustrated by discovery of a SINE family in the genome of the bat Myotis daubentoni. Members of this SINE family termed VES have an additional B-like box, a putative polyadenylation signal and RNA polymerase III terminator.     

Creation of a SINE enriched library for the isolation of polymorphic (AGC)n microsatellite markers in the bovine genome

Trinucleotide (AGC)_n microsatellites are found as 3′ tails of the artiodactyl short interspersed nuclear element (SINE) A-dimer. We describe a polymerase chain reaction (PCR)-based method for the construction of a plasmid library enriched for SINE (AGC)_n microsatellites. By amplifying Sau3AI inserts with a conserved SINE primer and a flanking vector primer, a 35-fold enrichment of (AGC)_n microsatellites over a conventional genomic library was obtained. The SINE primer was used for both sequencing of AGC-containing inserts and analysis of polymorphism. Twenty-three unique reverse primers were synthesized and used on bovine genomic DNA, 21 producing PCR products of expected size. Five polymorphic (AGC)_n microsatellites with 2–4 alleles each were characterized. Allele sizes differed by a 3 bp motif and lacked the stutter bands associated with dinucleotide repeats. A tendency of increased polymorphism for longer AGC repeat arrays was observed. High stringency selection for positive clones containing eight or more AGC repeats can thus facilitate the isolation of polymorphic (AGC)_n microsatellites, Enrichment for (AGC), microsatellites by SINE-vector PCR can be applied to other bovidae species, such as sheep or goat, containing the artiodactyl SINE elements.     

A novel approach for identifying candidate imprinted genes through sequence analysis of imprinted and control genes

Through the sequence analysis of 27 imprinted human genes and a set of 100 control genes we have developed a novel approach for identifying candidate imprinted genes based on the differences in sequence composition observed. The imprinted genes were found to be associated with significantly reduced numbers of short interspersed transposable element (SINE) Alus and mammalian-wide interspersed repeat (MIR) repeat elements, as previously reported. In addition, a significant association between imprinted genes and increased numbers of low-complexity repeats was also evident. Numbers of the Alu classes AluJ and AluS were found to be significantly depleted in some parts of the flanking regions of imprinted genes. A recent study has proposed that there is active selection against SINE elements in imprinted regions. Alternatively, there may be differences in the rates of insertion of Alu elements. Our study indicates that this difference extends both upstream and downstream of the coding region. This and other consistent differences between the sequence characteristics of imprinted and control genes has enabled us to develop discriminant analysis, which can be used to screen the genome for candidate imprinted genes. We have applied this function to a number of genes whose imprinting status is disputed or uncertain.     

Novel SINEs families in Medicago truncatula and Lotus japonicus: bioinformatic analysis

Although short interspersed elements (SINEs) were discovered nearly 30 years ago, the studies of these genomic repeats were mostly limited to animal genomes. Very little is known about SINEs in legumes--one of the most important plant families. Here we report identification, genomic distribution and molecular features of six novel SINE elements in Lotus japonicus (named LJ_SINE-1, -2, -3) and Medicago truncatula (MT_SINE-1, -2, -3), model species of legume. They possess all the structural features commonly found in short interspersed elements including RNA polymerase III promoter, polyA tail and flanking repeats. SINEs described here are present in low to moderate copy numbers from 150 to 3000. Bioinformatic analyses were used to searched public databases, we have shown that three of new SINE elements from M. truncatula seem to be characteristic of Medicago and Trifolium genera. Two SINE families have been found in L. japonicus and one is present in both M. truncatula and L. japonicus. In addition, we are discussing potential activities of the described elements.     

SINE retroposons can be used in vivo as nucleation centers for de novo methylation

SINEs (short interspersed elements) are an abundant class of transposable elements found in a wide variety of eukaryotes. Using the genomic sequencing technique, we observed that plant S1 SINE retroposons mainly integrate in hypomethylated DNA regions and are targeted by methylases. Methylation can then spread from the SINE into flanking genomic sequences, creating distal epigenetic modifications. This methylation spreading is vectorially directed upstream or downstream of the S1 element, suggesting that it could be facilitated when a potentially good methylatable sequence is single stranded during DNA replication, particularly when located on the lagging strand. Replication of a short methylated DNA region could thus lead to the de novo methylation of upstream or downstream adjacent sequences.