McrBC: a multisubunit GTP-dependent restriction endonuclease.

McrBC-mediated restriction of modified DNA has been studied extensively by genetic methods, but little is known of its molecular action. We have used overproducing plasmid constructs to facilitate purification of the McrBL and McrC proteins, and report preliminary characterization of the activity of the complex. Both proteins are required for cleavage of appropriately modified DNA in vitro, in a reaction absolutely dependent on GTP. ATP inhibits the reaction. The sequence and modification requirements for cleavage of the substrate reflect those seen in vivo. The position of cleavage was examined at the nucleotide level, revealing that cleavage occurs at multiple positions in a small region. Based upon these observations, and upon cleavage of model oligonucleotide substrates, it is proposed that the recognition site for this enzyme consists of the motif RmC(N40-80)RmC, with cleavage occurring at multiple positions on both strands, between the modified C residues. In subunit composition, cofactor requirement, and relation between cleavage and recognition site, McrBC does not fit into any of the classes (types I to IV) of restriction enzyme so far described.     

The McrBC endonuclease translocates DNA in a reaction dependent on GTP hydrolysis.

McrBC specifically recognizes and cleaves methylated DNA in a reaction dependent on GTP hydrolysis. DNA cleavage requires at least two recognition sites that are optimally separated by 40-80 bp, but can be spaced as far as 3 kb apart. The nature of the communication between two recognition sites was analyzed on DNA substrates containing one or two recognition sites. DNA cleavage of circular DNA required only one methylated recognition site, whereas the linearized form of this substrate was not cleaved. However, the linearized substrate was cleaved if a Lac repressor was bound adjacent to the recognition site. These results suggest a model in which communication between two remote sites is accomplished by DNA translocation rather than looping. A mutant protein with defective GTPase activity cleaved substrates with closely spaced recognition sites, but not substrates where the sites were further apart. This indicates that McrBC translocates DNA in a reaction dependent on GTP hydrolysis. We suggest that DNA cleavage occurs by the encounter of two DNA-translocating McrBC complexes, or can be triggered by non-specific physical obstacles like the Lac repressor bound on the enzyme's path along DNA. Our results indicate that McrBC belongs to the general class of DNA "motor proteins", which use the free energy associated with nucleoside 5'-triphosphate hydrolysis to translocate along DNA.     

The recognition domain of the methyl-specific endonuclease McrBC flips out 5-methylcytosine

DNA cytosine methylation is a widespread epigenetic mark. Biological effects of DNA methylation are mediated by the proteins that preferentially bind to 5-methylcytosine (5mC) in different sequence contexts. Until now two different structural mechanisms have been established for 5mC recognition in eukaryotes; however, it is still unknown how discrimination of the 5mC modification is achieved in prokaryotes. Here we report the crystal structure of the N-terminal DNA-binding domain (McrB-N) of the methyl-specific endonuclease McrBC from Escherichia coli. The McrB-N protein shows a novel DNA-binding fold adapted for 5mC-recognition. In the McrB-N structure in complex with methylated DNA, the 5mC base is flipped out from the DNA duplex and positioned within a binding pocket. Base flipping elegantly explains why McrBC system restricts only T4-even phages impaired in glycosylation [Luria, S.E. and Human, M.L. (1952) A nonhereditary, host-induced variation of bacterial viruses. J. Bacteriol., 64, 557-569]: flipped out 5-hydroxymethylcytosine is accommodated in the binding pocket but there is no room for the glycosylated base. The mechanism for 5mC recognition employed by McrB-N is highly reminiscent of that for eukaryotic SRA domains, despite the differences in their protein folds.     

Human mitochondrial ClpP is a stable heptamer that assembles into a tetradecamer in the presence of ClpX

The functional form of ClpP, the proteolytic component of ATP-dependent Clp proteases, is a hollow-cored particle composed of two heptameric rings joined face-to-face forming an aqueous chamber containing the proteolytic active sites. We have found that isolated human mitochondrial ClpP (hClpP) is stable as a heptamer and remains a monodisperse species (s(20,w) 7.0 S; M(app) 169, 200) at concentrations > or = 3 mg/ml. Heptameric hClpP has no proteolytic activity and very low peptidase activity. In the presence of ATP, hClpX interacts with hClpP forming a complex, which by equilibrium sedimentation measurements has a M(app) of 1 x 10(6). Electron microscopy confirmed that the complex consisted of a double ring of hClpP with an hClpX ring axially aligned on each end. The hClpXP complex has protease activity and greatly increased peptidase activity, indicating that interaction with hClpX affects the conformation of the hClpP catalytic active site. A mutant of hClpP, in which a cysteine residue was introduced into the handle region at the interface between the two rings formed stable tetradecamers under oxidizing conditions but spontaneously dissociated into two heptamers upon reduction. Thus, hClpP rings interact transiently but very weakly in solution, and hClpX must exert an allosteric effect on hClpP to promote a conformation that stabilizes the tetradecamer. These data suggest that hClpX can regulate the appearance of hClpP peptidase activity in mitochondria and might affect the nature of the degradation products released during ATP-dependent proteolytic cycles.     

Purification of cohesive-end-producing restriction endonuclease from Bacillus subtilis G.

A new restriction endonuclease was partially purified from Bacillus subtilis G (IAM1247). This restriction endonuclease (endonuclease RBsuG) seems to produce cohesive ends at its cleavage site.     

Lack of regulation of the modification-dependent restriction enzyme McrBC in Escherichia coli

Restriction alleviation (RA) by the type I restriction enzyme EcoKI is caused by treatments that damage DNA. RA is due to proteolysis of the EcoKI HsdR subunit by the ClpXP ATP-dependent protease. Here we show that the modification-dependent enzyme McrBC is not subject to RA, although it is moderately sensitive to ClpAP.     

Design of endonuclease restriction sites into primers for PCR cloning

I present a software system PCRCLNG that facilitates the design of endonuclease restriction sites into the 5'-end of PCR primers. The product amplified using these primers can be directly cloned into vectors. The program estimates the annealing temperature for each primer and selects the primer pairs with comparable annealing temperature. Finally the software determines whether the PCR product can be cloned into the vector to generate in-frame gene fusion.     

Binding of non-substrate nucleotides to a restriction endonuclease: a model for the interaction of bam HI with its recognition sequence

The kinetic constants of the site-specific endonuclease Bam HI for various substrates were determined and binding of non-substrate nucleotides to the enzyme was studied. Agarose gel assays in combination with an integrated Michaelis-Menten equation were used for the evaluation of data. The turnover number was 2.2 min-1 at 37 degrees C with pJC80 DNA as the substrate. It depends on the conformation and base composition of the substrate. Michaelis constants also depend on substrate conformation. Non-substrate polynucleotides were found to inhibit Bam competitively with KI ranging from 10(-6) to > 10(-3) M depending on base composition, base pairing, and helix conformation. Dinucleotides showed sequence-specific, competitive inhibition with KIs ranging from 10(-5) to > 10(-3) M. Mononucleotides and -nucleosides acted noncompetitively. Binding was influenced by the extent of phosphorylation, but not by the nature of the base. KIs varied between 10(-3) and 10(-2) M. The results are discussed with respect to the recognition requirements of Bam HI.     

The essential carboxyl group in restriction endonuclease EcoRI

We have carried out studies on type II restriction endonuclease EcoRI, which cleaves the DNA sequence 5'd(-G-A-A-T-T-C-)3', as indicated. The active form of the enzyme consists of two subunits, each 31063 molecular weight. A water-soluble reagent, 1-cyclohexyl-3-(2-morpholinoethyl)carbodiimide metho-p-sulphonate, which reacts with carboxyl groups and also with tyrosine and cysteine residues, has been found to inactivate this enzyme. Results are presented which show the following. (1) This specific inactivation is not due to modification of tyrosine or cysteine residues. (2) There is one carboxyl group per subunit which, when modified with carbodiimide, inactivates the enzyme. (3) phi X174 DNA (which does not contain EcoRI sites) partially protects the enzyme from the carbodiimide; protection is unaffected by the additional presence of Mg2+, but significantly greater with Co2+ and phi X174 DNA.     

Comparison of a stat method of analysis of microorganisms for the presence of site-specific restriction endonuclease activity]

Sensitivity of several express-methods used for detection of bacterial endonucleases was compared. The most sensitive method is that employing Triton X-100.     

The stereochemical course of the restriction endonuclease EcoRI-catalyzed reaction

The restriction endonuclease EcoRI hydrolyzes the Rp diastereomer of d(pGGsAATTCC), an analogue of d(pGGAATTCC) containing a chiral phosphorothioate group at the cleavage site between the deoxyguanosine and the deoxyadenosine residues (Connolly, B.A., Potter, B.V.L., Eckstein, F., Pingoud, A., and Grotjahn, L. (1984) Biochemistry 23, 3343-3453). Performing the reaction in H2(18)O leads to d(pGG) and the hexanucleotide d([18O, S]pAATTCC) which has an 18O-containing phosphorothioate group at the 5' terminus. Further hydrolysis of this hexamer with nuclease P1 yields deoxyadenosine 5'-O-[18O]phosphorothioate which can be stereospecifically phosphorylated with adenylate kinase and pyruvate kinase to give Sp-[18O] deoxyadenosine 5'-O-(1-thiotriphosphate). 31P NMR spectroscopy shows the oxygen-18 in this compound to be in a bridging position between the alpha- and beta-phosphorus atoms. Thus, the hydrolysis reaction catalyzed by EcoRI proceeds with inversion of configuration at phosphorus. This result is compatible with a direct enzyme-catalyzed nucleophilic attack of H2O at phosphorus without involvement of a covalent enzyme intermediate.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

Conversion of the tetrameric restriction endonuclease Bse634I into a dimer: oligomeric structure-stability-function correlations

The Bse634I restriction endonuclease is a tetramer and belongs to the type IIF subtype of restriction enzymes. It requires two recognition sites for its optimal activity and cleaves plasmid DNA with two sites much faster than a single-site DNA. We show that disruption of the tetramerisation interface of Bse634I by site-directed mutagenesis converts the tetrameric enzyme into a dimer. Dimeric W228A mutant cleaves plasmid DNA containing one or two sites with the same efficiency as the tetramer cleaves the two-site plasmid. Hence, the catalytic activity of the Bse634I tetramer on a single-site DNA is down-regulated due to the cross-talking interactions between the individual dimers. The autoinhibition within the Bse634I tetramer is relieved by bridging two DNA copies into the synaptic complex that promotes fast and concerted cleavage at both sites. Cleavage analysis of the oligonucleotide attached to the solid support revealed that Bse634I is able to form catalytically competent synaptic complexes by bridging two molecules of the cognate DNA, cognate DNA-miscognate DNA and cognate DNA-product DNA. Taken together, our data demonstrate that a single W228A mutation converts a tetrameric type IIF restriction enzyme Bse634I into the orthodox dimeric type IIP restriction endonuclease. However, the stability of the dimer towards chemical denaturants, thermal inactivation and proteolytic degradation are compromised.     

The DNA sequence recognised by the HinfIII restriction endonuclease

HinfIII is a type III restriction enzyme (Kauc &; Piekarowicz, 1978) isolated from Haemophilus influenzae Rf. Like other type III restriction endonucleases, the enzyme also catalyses the modification of susceptible DNA. It requires ATP for DNA cleavage and S-adenosyl methionine for DNA methylation. We have determined the DNA sequence recognised by HinfIII to be:

$\text{5′-C-G-A-A-T-3′}\text{·····3′-G-C-T-T-A-5′}$

In restriction, the enzyme cleaves the DNA about 25 base-pairs to the right of this sequence. In the modification reaction only one of the strands is methylated, that containing the 5′-C-G-A-A-T-3′ sequence.     

The cleavage site of the restriction endonuclease Ava II.

We have determined that the type II restriction enzyme Ava II, isolated from Anabaena variabilis, recognizes and cuts the sequence (formula: see article). The eight Ava II sites of pBR322 have been mapped, as well as a unique site for Ava I.     

Relaxed specificity of the EcoRV restriction endonuclease

The EcoRV restriction endonuclease normally shows a high specificity for its recognition site on DNA, GATATC. In standard reactions, it cleaves DNA at this site several orders of magnitude more readily than at any alternative sequence. But in the presence of dimethyl sulphoxide and at high pH, the EcoRV enzyme cleaves DNA at several sites that differ from its recognition site by one nucleotide. Of the 18 (3 X 6) possible sequences that differ from GATATC by one base, all were cleaved readily except for the following 4 sites: TATATC, CATATC, GATATA and GATATG. However, two of the sites that could be cleaved by EcoRV in the presence of dimethyl sulphoxide, GAGATC and GATCTC, were only cleaved on DNA that lacked dam methylation: both contain the sequence GATC, the recognition site for the dam methylase of Escherichia coli.