Affinity and sequence specificity of DNA binding and site selection for primer synthesis by Escherichia coli primase

Primase is an essential DNA replication enzyme in Escherichia coli and responsible for primer synthesis during lagging strand DNA replication. Although the interaction of primase with single-stranded DNA plays an important role in primer RNA and Okazaki fragment synthesis, the mechanism of DNA binding and site selection for primer synthesis remains unknown. We have analyzed the energetics of DNA binding and the mechanism of site selection for the initiation of primer RNA synthesis on the lagging strand of the replication fork. Quantitative analysis of DNA binding by primase was carried out using a number of oligonucleotide sequences: oligo(dT)(25) and a 30 bp oligonucleotide derived from bacteriophage G4 origin (G4ori-wt). Primase bound both sequences with moderate affinity (K(d) = 1.2-1.4 x 10(-)(7) M); however, binding was stronger for G4ori-wt. G4ori-wt contained a CTG trinucleotide, which is a preferred site for initiation of primer synthesis. Analysis of DNA binding isotherms derived from primase binding to the oligonucleotide sequences by fluorescence anisotropy indicated that primase bound to DNA as a dimer, and this finding was further substantiated by electrophoretic mobility shift assays (EMSAs) and UV cross-linking of the primase-DNA complex. Dissection of the energetics involved in the primase-DNA interaction revealed a higher affinity of primase for DNA sequences containing the CTG triplet. This sequence preference of primase may likely be responsible for the initiation of primer synthesis in the CTG triplet sites in the E. coli lagging strand as well as in the origin of replication of bacteriophage G4.     

Identification of non-telomeric G4-DNA binding proteins in human,E. coli,yeast, and Arabidopsis

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.     

Elongation factor Tu ternary complex binds to small ribosomal subunits in a functionally active state

A complex between elongation factor Tu (EF-Tu), GTP, phenylalanyl-tRNA (Phe-tRNA), oligo(uridylic acid) [oligo(U)], and the 30S ribosomal subunit of Escherichia coli has been formed and isolated. Binding of the EF-Tu complex appears to be at the functionally active 30S site, by all biochemical criteria that were examined. The complex can be isolated with 0.25-0.5 copy of EF-Tu bound per ribosome. The binding is dependent upon the presence of both the aminoacyl-tRNA and the cognate messenger RNA. Addition of 50S subunits to the preformed 30S-EF-Tu-GTP-Phe-tRNA-oligo(U) complex ("30S-EF-Tu complex") causes a rapid hydrolysis of GTP. This hydrolysis is coordinated with the formation of 70S ribosomes and the release of EF-Tu. Both the release of EF-Tu and the hydrolysis of GTP are stoichiometric with the amount of added 50S subunits. 70S ribosomes, in contrast to 50S subunits, neither release EF-Tu nor rapidly hydrolyze GTP when added to the 30S-EF-Tu complexes. The inability of 70S ribosomes to react with the 30S-EF-Tu complex argues that the 30S-EF-Tu complex does not dissociate prior to reaction with the 50S subunit. The requirements of the 30S reaction for Phe-tRNA and oligo(U) and the consequences of the addition of 50S subunits resemble the reaction of EF-Tu with 70S ribosomes, although EF-Tu binding to isolated 30S subunits does not occur during the elongation microcycle. This suggests that the EF-Tu ternary complex binds to isolated 30S subunits at the same 30S site that is occupied during ternary complex interaction with the 70S ribosome.(ABSTRACT TRUNCATED AT 250 WORDS)     

The GTP-dependent restriction enzyme McrBC from Escherichia coli forms high-molecular mass complexes with DNA and produces a cleavage pattern with a characteristic 10-base pair repeat

The GTP-dependent restriction enzyme McrBC consists of two polypeptides: one (McrB) that is responsible for GTP binding and hydrolysis as well as DNA binding and another (McrC) that is responsible for DNA cleavage. It recognizes two methylated or hemimethylated RC sites (R(m)C) at a distance of approximately 30 to more than 2000 base pairs and cleaves the DNA close to one of the two R(m)C sites. This process is strictly coupled to GTP hydrolysis and involves the formation of high-molecular mass complexes. We show here using footprinting techniques, surface plasmon resonance, and scanning force microscopy experiments that in the absence of McrC, McrB binds to a single R(m)C site. If a second R(m)C site is present on the DNA, it is occupied independently by McrB. Whereas the DNA-binding domain of McrB forms 1:1 complexes with each R(m)C site and shows a clear footprint on both R(m)C sites, full-length McrB forms complexes with a stoichiometry of at least 4:1 at each R(m)C site, resulting in a slightly more extended footprint. In the presence of McrC, McrB forms high-molecular mass complexes of unknown stoichiometry, which are considerably larger than the complexes formed with McrB alone. In these complexes and when GTP is present, the DNA is cleaved next to one of the R(m)C sites at distances differing by one to five helical turns, suggesting that in the McrBC-DNA complex only a few topologically well-defined phosphodiester bonds of the DNA are accessible for the nucleolytic center of McrC.     

Mechanism of initiation of in vitro DNA synthesis by the immunopurified complex between yeast DNA polymerase I and DNA primase

The immunopurified yeast DNA-polymerase-I--DNA-primase complex synthesizes oligo(rA) and oligo(rG) molecules that are used as primer for replication of poly(dT) and poly(dC). Neither initiation nor DNA synthesis is observed with poly(dA) and poly(dI). Nitrocellulose-filter binding shows that the enzyme complex binds to deoxypyrimidine polymers, but not to deoxypurine polymers. Although the yeast complex initiates DNA synthesis on deoxypyrimidine homopolymers, it prefers to elongate pre-existing primer molecules rather than to initiate de novo DNA replication. The size of the oligo(rA) and oligo(rG) primer molecules has been determined by urea/polyacrylamide gel electrophoresis: longer oligoribonucleotides are synthesized when their utilization is prevented by omitting dNTP. An oligodeoxythymidylate template with a chain length as short as five residues can support oligo(rA) synthesis catalyzed by the yeast DNA-polymerase--DNA-primase complex and the size of the oligoribonucleotide products synthesized with oligodeoxythymidylate of differing chain length has also been determined. The mechanistic properties of the DNA-polymerase--DNA-primase complexes, purified from different eukaryotic organisms, appear to be very similar. The possible biological implication of the studies on the mechanism and specificity of initiation of DNA synthesis in a well-defined model template system has been discussed.     

Initiation of DNA synthesis by the calf thymus DNA polymerase-primase complex

The calf thymus DNA polymerase-alpha-primase complex purified by immunoaffinity chromatography catalyzes the synthesis of RNA initiators on phi X174 single-stranded viral DNA that are efficiently elongated by the DNA polymerase. Trace amounts of ATP and GTP are incorporated into products that are full length double-stranded circular DNAs. When synthetic polydeoxynucleotides are used as templates, initiation and DNA synthesis occurs with both poly(dT) and poly(dC), but neither initiation nor DNA synthesis was observed with poly(dA) and poly(dI) templates. Nitrocellulose filter binding and sucrose gradient centrifugation studies show that the DNA polymerase-primase complex binds to deoxypyrimidine polymers, but not to deoxypurine polymers. Using d(pA)-50 with 3'-oligo(dC) tails and d(pI)-50 with 3'-oligo(dT) tails, initiator synthesis and incorporation of deoxynucleotide can be demonstrated when the average pyrimidine sequence lengths are 8 and 4, respectively. These results suggest that purine polydeoxynucleotides are used as templates by the DNA polymerase only after initiation has occurred on the oligodeoxypyrimidine sequence and that the pyrimidine stretch required by the primase activity is relatively short. Analysis of initiator chain length with poly(dC) as template showed a series of oligo(G) initiators of 19-27 nucleotides in the absence of dGTP, and 5-13 nucleotides in the presence of dGTP. The chain length of initiators synthesized by the complex when poly(dT) or oligodeoxythymidylate-tailed poly(dI) was used can be as short as a dinucleotide. Analysis of the products of replication of oligo(dC)-tailed poly(dA) shows that initiator with chain length as low as 4 can be used for initiation by the polymerase-primase complex.     

Characterization of a novel DNA primase from the Salmonella typhimurium bacteriophage SP6

The gene for the DNA primase encoded by Salmonella typhimurium bacteriophage SP6 has been cloned and expressed in Escherichia coli and its 74-kDa protein product purified to homogeneity. The SP6 primase is a DNA-dependent RNA polymerase that synthesizes short oligoribonucleotides containing each of the four canonical ribonucleotides. GTP and CTP are both required for the initiation of oligoribonucleotide synthesis. In reactions containing only GTP and CTP, SP6 primase incorporates GTP at the 5'-end of oligoribonucleotides and CMP at the second position. On synthetic DNA templates, pppGpC dinucleotides are synthesized most rapidly in the presence of the sequence 5'-GCA-3'. This trinucleotide sequence, containing a cryptic dA at the 3'-end, differs from other known bacterial and phage primase recognition sites. SP6 primase shares some properties with the well-characterized E. colibacteriophage T7 primase. The T7 DNA polymerase can use oligoribonucleotides synthesized by SP6 primase as primers for DNA synthesis. However, oligoribonucleotide synthesis by SP6 primase is not stimulated by either the E. coli- or the T7-encoded ssDNA binding protein. An amino acid sequence alignment of the SP6 and T7 primases, which share only 22.4% amino acid identity, indicates amino acids likely critical for oligoribonucleotide synthesis as well as a putative Cys(3)His zinc finger motif that may be involved in DNA binding.     

The G222D mutation in elongation factor Tu inhibits the codon-induced conformational changes leading to GTPase activation on the ribosome.

Elongation factor Tu (EF-Tu) from Escherichia coli carrying the mutation G222D is unable to hydrolyze GTP on the ribosome and to sustain polypeptide synthesis at near physiological Mg2+ concentration, although the interactions with guanine nucleotides and aminoacyl-tRNA are not changed significantly. GTPase and polypeptide synthesis activities are restored by increasing the Mg2+ concentration. Here we report a pre-steady-state kinetic study of the binding of the ternary complexes of wild-type and mutant EF-Tu with Phe-tRNA(Phe) and GTP to the A site of poly(U)-programed ribosomes. The kinetic parameters of initial binding to the ribosome and subsequent codon-anticodon interaction are similar for mutant and wild-type EF-Tu, independent of the Mg2+ concentration, suggesting that the initial interaction with the ribosome is not affected by the mutation. Codon recognition following initial binding is also not affected by the mutation. The main effect of the G222D mutation is the inhibition, at low Mg2+ concentration, of codon-induced structural transitions of the tRNA and, in particular, their transmission to EF-Tu that precedes GTP hydrolysis and the subsequent steps of A-site binding. Increasing the Mg2+ concentration to 10 mM restores the complete reaction sequence of A-site binding at close to wild-type rates. The inhibition of the structural transitions is probably due to the interference of the negative charge introduced by the mutation with negative charges either of the 3' terminus of the tRNA, bound in the vicinity of the mutated amino acid in domain 2 of EF-Tu, or of the ribosome. Increasing the Mg2+ concentration appears to overcome the inhibition by screening the negative charges.     

Specific and nonspecific interactions of integration host factor with oligo DNAs as revealed by circular dichroism spectroscopy and filter binding assay.

Binding specificity of integration host factor (IHF) to oligo DNAs has been studied by circular dichroism (CD) spectroscopy and filter binding experiment. CD difference spectra of IHF-DNA complexes demonstrated that a conformational change in DNA was induced by binding of IHF when DNA had a consensus sequence for the binding sites of IHF, but that such conformational change was not observed for consensus DNA 20 mer as well as nonconsensus DNA 45 mer. Dissociation constants for IHF-DNA complexes determined by filter binding assay showed that IHF has indeed stronger affinity to DNA with the consensus binding site than to nonconsensus DNA, but the difference in its affinity between consensus and nonconsensus DNAs was rather small, 3.4-fold. It was, therefore, concluded that the flanking regions of the consensus sequence are important for the specific binding of IHF and that its binding specificity is well characterized by the induced conformational change in DNA rather than by dissociation constants for IHF-DNA complexes.     

Characterization of pokeweed antiviral protein binding to mRNA cap analogs: competition with nucleotides and enhancement by translation initiation factor iso4G

Pokeweed antiviral protein (PAP) is a type I ribosomal inactivating protein (RIP). PAP binds to and depurinates the sarcin/ricin loop (SRL) of ribosomal RNA resulting in the cessation of protein synthesis. PAP has also been shown to bind to mRNA cap analogs and depurinate mRNA downstream of the cap structure. The biological role of cap binding and its possible role in PAP activity are not known. Here we show the first direct quantitative evidence for PAP binding to the cap analog m(7)GTP. We report a binding affinity of 43.3+/-0.1 nM at 25 degrees C as determined by fluorescence quenching experiments. This is similar to the values reported for wheat cap-binding proteins eIFiso4E and eIFiso4F. van't Hoff analysis of m(7)GTP-PAP equilibrium reveals a binding reaction that is enthalpy driven and entropy favored with TDeltaS degrees contributing 15% to the overall value of DeltaG degrees . This is in contrast to the wheat cap-binding proteins which are enthalpically driven in the DeltaG degrees for binding. Competition experiments indicate that ATP and GTP compete for the cap-binding site on PAP with slightly different affinities. Fluorescence studies of PAP-eIFiso4G binding reveal a protein-protein interaction with a K(d) of 108.4+/-0.3 nM. eIFiso4G was shown to enhance the interaction of PAP with m(7)GTP cap analog by 2.4-fold. These results suggest the involvement of PAP-translation initiation factor complexes in RNA selection and depurination.     

DNA binding properties of the Saccharomyces cerevisiae DAT1 gene product.

The DAT1 gene of Saccharomyces cerevisiae encodes a DNA binding protein (Dat1p) that specifically recognizes the minor groove of non-alternating oligo(A).oligo(T) tracts. Sequence-specific recognition requires arginine residues found within three perfectly repeated pentads (G-R-K-P-G) of the Dat1p DNA binding domain [Reardon, B. J., Winters, R. S., Gordon, D., and Winter, E. (1993) Proc. Natl. Acad. Sci. USA 90, 11327-1131]. This report describes a rapid and simple method for purifying the Dat1p DNA binding domain and the biochemical characterization of its interaction with oligo(A).oligo(T) tracts. Oligonucleotide binding experiments and the characterization of yeast genomic Dat1p binding sites show that Dat1p specifically binds to any 11 base sequence in which 10 bases conform to an oligo(A).oligo(T) tract. Binding studies of different sized Dat1p derivatives show that the Dat1p DNA binding domain can function as a monomer. Competition DNA binding assays using poly(I).poly(C), demonstrate that the minor groove oligo(A).oligo(T) constituents are not sufficient for high specificity DNA binding. These data constrain the possible models for Dat1p/oligo(A).oligo(T) complexes, suggest that the DNA binding domain is in an extended structure when complexed to its cognate DNA, and show that Dat1p binding sites are more prevalent than previously thought.     

Identification of the cap binding domain of human recombinant eukaryotic protein synthesis initiation factor 4E using a photoaffinity analogue.

Binding of eIF-4E to the 5' m7G cap structure of eukaryotic mRNA signals the initiation of protein synthesis. In order to investigate the molecular basis for this recognition, photoaffinity labeling with [gamma-32P]8-N3GTP was used in binding site studies of human recombinant cap binding protein eIF-4E. Competitive inhibition of this cap analogue by m7GTP and capped mRNA indicated probe specificity for interaction at the protein binding site. Saturation of the binding site with [gamma-32P]8-N3GTP further demonstrated the selectivity of photoinsertion. Aluminum (III)-chelate chromatography and reverse-phase HPLC were used to isolate the binding site peptide resulting from digestion of photolabeled eIF-4E with modified trypsin. Amino acid sequencing identified the binding domain as the region containing the sequence Trp 113-Arg 122.Lys 119 was not identified in sequencing analysis nor was it cleaved by trypsin. These results indicate that Lys 119 is the residue directly modified by photoinsertion of [gamma-32P]8-N3GTP. A detailed understanding of eIF-4E.m7G mRNA cap interactions may lead the way to regulating this essential protein-RNA interaction for specific mRNA in vivo.     

Lid L11 of the glutamine amidotransferase domain of CTP synthase mediates allosteric GTP activation of glutaminase activity

GTP is an allosteric activator of CTP synthase and acts to increase the k(cat) for the glutamine-dependent CTP synthesis reaction. GTP is suggested, in part, to optimally orient the oxy-anion hole for hydrolysis of glutamine that takes place in the glutamine amidotransferase class I (GATase) domain of CTP synthase. In the GATase domain of the recently published structures of the Escherichia coli and Thermus thermophilus CTP synthases a loop region immediately proceeding amino acid residues forming the oxy-anion hole and named lid L11 is shown for the latter enzyme to be flexible and change position depending on the presence or absence of glutamine in the glutamine binding site. Displacement or rearrangement of this loop may provide a means for the suggested role of allosteric activation by GTP to optimize the oxy-anion hole for glutamine hydrolysis. Arg359, Gly360 and Glu362 of the Lactococcus lactis enzyme are highly conserved residues in lid L11 and we have analyzed their possible role in GTP activation. Characterization of the mutant enzymes R359M, R359P, G360A and G360P indicated that both Arg359 and Gly360 are involved in the allosteric response to GTP binding whereas the E362Q enzyme behaved like wild-type enzyme. Apart from the G360A enzyme, the results from kinetic analysis of the enzymes altered at position 359 and 360 showed a 10- to 50-fold decrease in GTP activation of glutamine dependent CTP synthesis and concomitant four- to 10-fold increases in K(A) for GTP. The R359M, R359P and G360P also showed no GTP activation of the uncoupled glutaminase reaction whereas the G360A enzyme was about twofold more active than wild-type enzyme. The elevated K(A) for GTP and reduced GTP activation of CTP synthesis of the mutant enzymes are in agreement with a predicted interaction of bound GTP with lid L11 and indicate that the GTP activation of glutamine dependent CTP synthesis may be explained by structural rearrangements around the oxy-anion hole of the GATase domain.     

Position 127 amino acid substitutions affect the formation of CRP:cAMP:lacP complexes but not CRP:cAMP:RNA polymerase complexes at lacP.

The lacP DNA binding and activation characteristics of CRP having amino acid substitutions at position 127 were investigated. Wild-type (WT) and T127C CRP footprinted lacP DNA in the presence of DNase I in a cAMP-dependent manner. The T127G, T127I, and T127S forms of CRP failed to footprint lacP both in the absence and in the presence of cAMP. Consistent with these data, WT and T127C CRP:cAMP complexes exhibited high affinity for the lacP CRP site whereas T127G, T127I, or T127S CRP:cAMP complexes exhibited low affinity for the lacP CRP site. CRP:cAMP:RNA polymerase (RNAP) complexes formed at lacP in reactions that contained WT, T127C, T127G, T127I, or T127S CRP. These results demonstrate that allosteric changes important for cAMP-mediated CRP activation are differentially affected by amino acid substitution at position 127. Proper cAMP-mediated reorientation of the DNA binding helices required either threonine or cysteine at position 127. However, cAMP-dependent interaction of CRP with RNAP was accomplished regardless of the amino acid at position 127. RNAP:lacP complexes that supported high-level lac RNA synthesis formed rapidly in reactions that contained WT or T127C CRP whereas RNAP:lacP complexes that supported only low-level lac RNA synthesis formed at slower rates in reactions that contained T127I or T127S CRP. The T127G CRP:cAMP:RNAP:lacP complex failed to activate lacP. The results of this study lead us to conclude that threonine 127 plays an important role in transduction of the signal from the CRP cyclic nucleotide binding pocket that promotes proper orientation of the DNA binding helices and only a minor, if any, role in the functional exposure of the CRP RNAP interaction domain.     

GTP binding and signaling by Gh/transglutaminase II involves distinct residues in a unique GTP-binding pocket

G(h) is a dual function protein. It has receptor signaling activity that requires GTP binding and Ca(2+)-activated transglutaminase (TGase) activity that is inhibited by GTP binding. G(h) shows no homology with other GTP-binding proteins, and its GTP-binding site has not been defined. Based on sequence analysis of [alpha-(32)P]GTP-photolabeled and proteolytically released internal peptide fragments, we report localization of GTP binding to a 15-residue segment ((159)YVLTQQGFIYQGSVK(173)) of the G(h) core domain. This was confirmed by site-directed mutagenesis; a G(h)/fXIIIA chimera (in which residues 162-179 of G(h) were substituted with the equivalent but nonhomologous region of the non-GTP-binding TGase factor XIIIA) and a G(h) point mutant, S171E, retained TGase activity but failed to bind and hydrolyze GTP and did not support alpha(1B)-adrenergic receptor signaling. Slight impairment of GTP binding (1.5-fold) and hydrolysis (10-fold) in the absence of altered TGase activity did not affect signaling by the mutant K173N. However, greater impairment of GTP binding (6-fold) and hydrolysis (50-fold) abolished signaling by the mutant K173L. Mutant S171C exhibited enhanced GTP binding and signaling. Thus, residues Ser(171) and Lys(173) are critical for both GTP binding and signaling but not TGase activity. Mutagenesis of residues N-terminal to Gly(170) impaired both GTP binding and TGase activity. From computer modeling of G(h), it is evident that the GTP-binding region identified here is distinct from, but interacts with, the TGase active site. Together with structural considerations of G(h) versus other GTP-binding proteins, these findings indicate that G(h) has a unique GTP-binding pocket and provide for the first time a mechanism for GTP-mediated regulation of the TGase activity of G(h).     

Molecular probes of DNA bulges: functional assay and spectroscopic analysis

Bulged structures in DNA and RNA have been linked to biomolecular processes involved in numerous diseases, thus probes with affinity for these nucleic acid targets would be of considerable utility to chemical biologists. Herein, we report guided chemical synthesis of small molecules capable of binding to DNA bulges by virtue of their unique (spirocyclic) geometry. The agents, modeled on a natural product congener, show pronounced selectivity for specific bulged motifs and are able to enhance slipped DNA synthesis, a hallmark functional assay of bulge binding. Significantly, bulge-agent complexes demonstrate characteristic fluorescent signatures depending on bulge and flanking sequence in the oligo. It is anticipated that these signature patterns can be harnessed as molecular probes of bulged hotspots in DNA and RNA.     

Factor D is a selective single-stranded oligodeoxythymidine binding protein.

Factor D, a protein purified from rabbit liver that selectively enhances traversal of template oligodeoxythymidine tracts by diverse DNA polymerases, was examined for the sequence specificity of its binding to DNA. Terminally [32P]-labeled oligomers with the sequence 5'-d[AATTC(N)16G]-3', N being dT, dA, dG, or dC, were interacted with purified factor D and examined for the formation of protein-DNA complexes that exhibit retarded electrophoretic mobility under nondenaturing conditions. Whereas significant binding of factor D to 5'-d[AATTC(T)16G]-3' is detected, there is no discernable association between this protein and oligomers that contain 16 contiguous moieties of dG, dA, or dC. Furthermore, factor D does not form detectable complexes with the duplexes oligo(dA).oligo(dT) or poly(dA).poly(dT). The preferential interaction of factor D with single-stranded poly(dT) is confirmed by experiments in which the polymerase-enhancing activity of this protein is protected by poly(dT) against heat inactivation two- and four-fold more efficiently than by poly(dA) or poly(dA).poly(dT), respectively.     

Binding of the 3'' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA.