Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.     

Sequences of a hairpin structure in the 3'-untranslated region mediate regulation of human pulmonary surfactant protein B mRNA stability

The ability of pulmonary surfactant to reduce alveolar surface tension requires adequate expression of surfactant protein B (SP-B). Dexamethasone (DEX, 10(-7) M) increases human SP-B mRNA stability by a mechanism that requires a 126-nt-long segment (the 7.6S region) of the 3'-untranslated region (3'-UTR). The objective of this study was to identify sequences in the 7.6S region that mediate regulation of SP-B mRNA stability. The 7.6S region was found to be sufficient for DEX-mediated stabilization of mRNA. Sequential substitution mutagenesis of the 7.6S region indicates that a 90-nt region is required for DEX-mediated stabilization and maintenance of intrinsic stability. In this region, one 30-nt-long element (002), predicted to form a stem-loop structure, is sufficient for DEX-mediated stabilization of mRNA and intrinsic mRNA stability. Cytosolic proteins specifically bind element 002, and binding activity is unaffected whether proteins are isolated from cells incubated in the absence or presence of DEX. While loop sequences of element 002 have no role in regulation of SP-B mRNA stability, the proximal stem sequences are required for DEX-mediated stabilization and specific binding of proteins. Mutation of the sequences that comprise the proximal or distal arm of the stem negates the destabilizing activity of element 002 on intrinsic SP-B mRNA stability. These results indicate that cytosolic proteins bind a single hairpin structure that mediates intrinsic and hormonal regulation of SP-B mRNA stability via mechanisms that involve sequences of the stems of the hairpin structure.     

Control of insulin mRNA stability in rat pancreatic islets. Regulatory role of a 3'-untranslated region pyrimidine-rich sequence.

Stabilization of insulin mRNA in response to glucose is a significant component of insulin production, but the mechanisms governing this process are unknown. We presently observe that insulin mRNA is a highly abundant messenger and that the content of this mRNA is mainly controlled by changes in messenger stability. We also demonstrate specific binding of the polypyrimidine tract-binding protein to a pyrimidine-rich sequence located in the 3'-untranslated region (3'-UTR) of insulin mRNA. This binding was increased in vitro by dithiothreitol and in vivo by glucose. Inhibition of polypyrimidine tract-binding protein binding to the pyrimidine-rich sequence by mutation of the core binding site resulted in a destabilization of a reporter gene mRNA. Thus, glucose-induced binding of polypyrimidine tract-binding protein to the 3'-UTR of insulin mRNA could be a necessary event in the control of insulin mRNA levels.     

Identification of two proteins that bind to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA.

GAP-43 is a membrane phosphoprotein that is important for the development and plasticity of neural connections. In undifferentiated PC12 pheochromocytoma cells, GAP-43 mRNA degrades rapidly ( t = 5 h), but becomes stable when cells are treated with nerve growth factor. To identify trans- acting factors that may influence mRNA stability, we combined column chromatography and gel mobility shift assays to isolate GAP-43 mRNA binding proteins from neonatal bovine brain tissue. This resulted in the isolation of two proteins that bind specifically and competitively to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA. Partial amino acid sequencing revealed that one of the RNA binding proteins coincides with FBP (far upstream element binding protein), previously characterized as a protein that resembles hnRNP K and which binds to a single-stranded, pyrimidine-rich DNA sequence upstream of the c -myc gene to activate its expression. The other binding protein shares sequence homology with PTB, a polypyrimidine tract binding protein implicated in RNA splicing and regulation of translation initiation. The two proteins bind to a 26 nt pyrimidine-rich sequence lying 300 nt downstream of the end of the coding region, in an area shown by others to confer instability on a reporter mRNA in transient transfection assays. We therefore propose that FBP and the PTB-like protein may compete for binding at the same site to influence the stability of GAP-43 mRNA.     

Post-transcriptional regulation of RNase-L expression is mediated by the 3'-untranslated region of its mRNA

RNase-L mediates critical cellular functions including antiviral, pro-apoptotic, and tumor suppressive activities; accordingly, its expression must be tightly regulated. Little is known about the control of RNASEL expression; therefore, we examined the potential regulatory role of a conserved 3'-untranslated region (3'-UTR) in its mRNA. The 3'-UTR mediated a potent decrease in the stability of RNase-L mRNA, and of a chimeric beta-globin-3'-UTR reporter mRNA. AU-rich elements (AREs) are cis-acting regulatory regions that modulate mRNA stability. Eight AREs were identified in the RNase-L 3'-UTR, and deletion analysis identified positive and negative regulatory regions associated with distinct AREs. In particular, AREs 7 and 8 served a strong positive regulatory function. HuR is an ARE-binding protein that stabilizes ARE-containing mRNAs, and a predicted HuR binding site was identified in the region comprising AREs 7 and 8. Co-transfection of HuR and RNase-L enhanced RNase-L expression and mRNA stability in a manner that was dependent on this 3'-UTR region. Immunoprecipitation demonstrated that RNase-L mRNA associates with a HuR containing complex in intact cells. Activation of endogenous HuR by cell stress, or during myoblast differentiation, increased RNase-L expression, suggesting that RNase-L mRNA is a physiologic target for HuR. HuR-dependent regulation of RNase-L enhanced its antiviral activity demonstrating the functional significance of this regulation. These findings identify a novel mechanism of RNase-L regulation mediated by its 3'-UTR.     

Vitamin D receptor 3'-untranslated region polymorphisms: lack of effect on mRNA stability

Allelic variation at the 3'-end of the vitamin D receptor (VDR) gene has been associated with a 3-5-fold increased risk of developing prostate cancer and with differences in bone mineralization. This genetic diversity does not alter the VDR protein structurally, but instead may be a marker(s) of other, nearby polymorphisms that influence message stability or translation. The work reported here was instigated to identify additional VDR 3'-UTR polymorphisms that may have functional significance and to then test whether these genetic variants alter message stability. Initially, four novel, frequently occurring sequence variants were identified that associated with two common haplotypes that were described previously. These common sequence variants were not found within three message-destabilizing elements that we mapped within the 3'-UTR of the vitamin D receptor mRNA. Furthermore, the two VDR 3'-UTR haplotypes conferred an identical half-life on a heterologous beta-globin reporter gene, in an in vitro assay. We therefore conclude that common polymorphisms within the VDR 3'-UTR do not influence message stability.     

Specific protein binding to a conserved region of the ornithine decarboxylase mRNA 5'-untranslated region.

An RNA gel retardation assay was used to identify one or more cellular protein(s) (ornithine decarboxylase mRNA 5'-UTR binding protein (ODCBP)) that bind specifically to a conserved region of the 5'-untranslated region (5'-UTR) of rat ornithine decarboxylase (ODC) mRNA. Ultraviolet light cross-linking demonstrated that this protein has an apparent Mr = 58,000 in mammalian cells. Treatment with the oxidizing agent diamide prevented binding of the ODCBP to ODC mRNA; addition of beta-mercaptoethanol reversed this inhibition and permitted mRNA.ODCBP complex formation. Cytoplasmic extracts from a variety of animal cells and tissues demonstrated similar binding activities; however, there was marked tissue-specific expression of the protein in the rat, with brain, heart, lung, and testis containing large amounts, and kidney, spleen, and skeletal muscle expressing negligible amounts. Binding was completely prevented by several mutations within a highly conserved heptanucleotide region (CCAU/ACUC) that was within 61 bases of the initiation codon in ODC mRNAs from mammals, Xenopus, and Caenorhabditis elegans; mutations 5' and 3' of the conserved heptanucleotide domain had no effect on binding activity. Binding was not affected by manipulation of cellular polyamine levels or by treatment of cells with agents that stimulate ODC biosynthesis. Thus, we have identified a widely distributed cellular protein that binds to a conserved domain within the 5'-UTR of ODC mRNA from many animal species; functional consequences of this binding remain to be determined.     

Translational regulation of Hsp90 mRNA. AUG-proximal 5'-untranslated region elements essential for preferential heat shock translation

Heat shock in Drosophila results in repression of most normal (non-heat shock) mRNA translation and the preferential translation of the heat shock mRNAs. The sequence elements that confer preferential translation have been localized to the 5'-untranslated region (5'-UTR) for Hsp22 and Hsp70 mRNAs (in Drosophila). Hsp90 mRNA is unique among the heat shock mRNAs in having extensive secondary structure in its 5'-UTR and being abundantly represented in the non-heat shocked cell. In this study, we show that Hsp90 mRNA translation is inefficient at normal growth temperature, and substantially activated by heat shock. Its preferential translation is not based on an IRES-mediated translation pathway, because overexpression of eIF4E-BP inhibits its translation (and the translation of Hsp70 mRNA). The ability of Hsp90 mRNA to be preferentially translated is conferred by its 5'-UTR, but, in contrast to Hsp22 and -70, is primarily influenced by nucleotides close to the AUG initiation codon. We present a model to account for Hsp90 mRNA translation, incorporating results indicating that heat shock inhibits eIF4F activity, and that Hsp90 mRNA translation is sensitive to eIF4F inactivation.