Genome-wide associated loci influencing interleukin (IL)-10, IL-1Ra, and IL-6 levels in African Americans

Interleukins (ILs) are key mediators of the immune response and inflammatory process. Plasma levels of IL-10, IL-1Ra, and IL-6 are associated with metabolic conditions, show large inter-individual variations, and are under strong genetic control. Therefore, elucidation of the genetic variants that influence levels of these ILs provides useful insights into mechanisms of immune response and pathogenesis of diseases. We conducted a genome-wide association study (GWAS) of IL-10, IL-1Ra, and IL-6 levels in 707 non-diabetic African Americans using 5,396,780 imputed and directly genotyped single nucleotide polymorphisms (SNPs) with adjustment for gender, age, and body mass index. IL-10 levels showed genome-wide significant associations (p < 5 × 10(-8)) with eight SNPs, the most significant of which was rs5743185 in the PMS1 gene (p = 2.30 × 10(-10)). We tested replication of SNPs that showed genome-wide significance in 425 non-diabetic individuals from West Africa, and successfully replicated rs17365948 in the YWHAZ gene (p = 0.02). IL-1Ra levels showed suggestive associations with two SNPs in the ASB3 gene (p = 2.55 × 10(-7)), ten SNPs in the IL-1 gene family (IL1F5, IL1F8, IL1F10, and IL1Ra, p = 1.04 × 10(-6) to 1.75 × 10(-6)), and 23 SNPs near the IL1A gene (p = 1.22 × 10(-6) to 1.63 × 10(-6)). We also successfully replicated rs4251961 (p = 0.009); this SNP was reported to be associated with IL-1Ra levels in a candidate gene study of Europeans. IL-6 levels showed genome-wide significant association with one SNP (RP11-314E23.1; chr6:133397598; p = 8.63 × 10(-9)). To our knowledge, this is the first GWAS on IL-10, IL-1Ra, and IL-6 levels. Follow-up of these findings may provide valuable insight into the pathobiology of IL actions and dysregulations in inflammation and human diseases.     

Resistin polymorphisms are associated with muscle, bone, and fat phenotypes in white men and women

Objective: The biological function of resistin (RST) is unknown, although it may have roles in obesity, diabetes, and insulin resistance. The objective of this study was to examine the effects of single nucleotide polymorphisms (SNPs) in the human RST gene on muscle, bone, and adipose tissue phenotypes and in response to resistance training (RT). Research Methods and Procedures: Subjects were white and consisted of strength (n = 482) and size (n = 409) cohorts who had not performed RT in the previous year. Subjects completed 12 weeks of structured, unilateral upper arm RT aimed at increasing the size and strength of the non‐dominant arm, using their dominant arm as an untrained control. Strength measurements were taken pre‐ and post‐12‐week RT and consisted of elbow flexor isometric strength and one‐repetition maximum during a biceps curl using free weights. Whole muscle, subcutaneous fat, and cortical bone volumes were measured by magnetic resonance imaging. Six RST SNPs were identified. Analysis of covariance was used to test for effects of the SNPs on pre‐ and post‐muscle strength and whole muscle, fat, and bone volumes independent of gender, age, and body weight. Results: Five RST SNPs (?537 A>C, ?420 C>G, 398 C>T, 540 G>A, 980 C>G) were associated with measured phenotypes among subjects when stratified by BMI (<25, ≥25 kg/m²). Several gender‐specific associations were observed between RST SNPs and phenotypes among individuals with a BMI ≥ 25. Conversely, only two associations were observed among individuals with a BMI < 25. Discussion: These data support previous identified associations of RST with adipose tissue and demonstrate additional associations with bone and skeletal muscle that warrant further investigation.     

WNT16 influences bone mineral density, cortical bone thickness, bone strength, and osteoporotic fracture risk

We aimed to identify genetic variants associated with cortical bone thickness (CBT) and bone mineral density (BMD) by performing two separate genome-wide association study (GWAS) meta-analyses for CBT in 3 cohorts comprising 5,878 European subjects and for BMD in 5 cohorts comprising 5,672 individuals. We then assessed selected single-nucleotide polymorphisms (SNPs) for osteoporotic fracture in 2,023 cases and 3,740 controls. Association with CBT and forearm BMD was tested for ～2.5 million SNPs in each cohort separately, and results were meta-analyzed using fixed effect meta-analysis. We identified a missense SNP (Thr>Ile; rs2707466) located in the WNT16 gene (7q31), associated with CBT (effect size of -0.11 standard deviations [SD] per C allele, P = 6.2 × 10(-9)). This SNP, as well as another nonsynonymous SNP rs2908004 (Gly>Arg), also had genome-wide significant association with forearm BMD (-0.14 SD per C allele, P = 2.3 × 10(-12), and -0.16 SD per G allele, P = 1.2 × 10(-15), respectively). Four genome-wide significant SNPs arising from BMD meta-analysis were tested for association with forearm fracture. SNP rs7776725 in FAM3C, a gene adjacent to WNT16, was associated with a genome-wide significant increased risk of forearm fracture (OR = 1.33, P = 7.3 × 10(-9)), with genome-wide suggestive signals from the two missense variants in WNT16 (rs2908004: OR = 1.22, P = 4.9 × 10(-6) and rs2707466: OR = 1.22, P = 7.2 × 10(-6)). We next generated a homozygous mouse with targeted disruption of Wnt16. Female Wnt16(-/-) mice had 27% (P<0.001) thinner cortical bones at the femur midshaft, and bone strength measures were reduced between 43%-61% (6.5 × 10(-13)相似文献   

IGF-II gene region polymorphisms related to exertional muscle damage.

We examined the association of a novel single-nucleotide polymorphism (SNP) in IGF-I (IGF-I -C1245T located in the promoter) and eight SNPs in the IGF-II gene region with indicators of muscle damage [strength loss, muscle soreness, and increases in circulating levels of creatine kinase (CK) and myoglobin] after eccentric exercise. We also examined two SNPs in the IGF binding protein-3 (IGFBP-3). The age, height, and body mass of the 151 subjects studied were 24.1 +/- 5.2 yr, 170.8 +/- 9.9 cm, and 73.3 +/- 17.0 kg, respectively. There were no significant associations of phenotypes with IGF-I. IGF-II SNP (G12655A, rs3213216) and IGFBP-3 SNP (A8618T, rs6670) were not significantly associated with any variable. The most significant finding in this study was that for men, IGF-II (C13790G, rs3213221), IGF-II (ApaI, G17200A, rs680), IGF-II antisense (IGF2AS) (G11711T, rs7924316), and IGFBP-3 (-C1592A, rs2132570) were significantly associated with muscle damage indicators. We found that men who were 1) homozygous for the rare IGF-II C13790G allele and rare allele for the ApaI (G17200A) SNP demonstrated the greatest strength loss immediately after exercise, greatest soreness, and highest postexercise serum CK activity; 2) homozygous wild type for IGF2AS (G11711T, rs7924316) had the greatest strength loss and most muscle soreness; and 3) homozygous wild type for the IGF2AS G11711T SNP showed the greatest strength loss, highest muscle soreness, and greater CK and myoglobin response to exercise. In women, fewer significant associations appeared.     

Do PTK2 gene polymorphisms contribute to the interindividual variability in muscle strength and the response to resistance training? A preliminary report

The protein tyrosine kinase-2 (PTK2) gene encodes focal adhesion kinase, a structural protein involved in lateral transmission of muscle fiber force. We investigated whether single-nucleotide polymorphisms (SNPs) of the PTK2 gene were associated with various indexes of human skeletal muscle strength and the interindividual variability in the strength responses to resistance training. We determined unilateral knee extension single repetition maximum (1-RM), maximum isometric voluntary contraction (MVC) knee joint torque, and quadriceps femoris muscle specific force (maximum force per unit physiological cross-sectional area) before and after 9 wk of knee extension resistance training in 51 untrained young men. All participants were genotyped for the PTK2 intronic rs7843014 A/C and 3'-untranslated region (UTR) rs7460 A/T SNPs. There were no genotype associations with baseline measures or posttraining changes in 1-RM or MVC. Although the training-induced increase in specific force was similar for all PTK2 genotypes, baseline specific force was higher in PTK2 rs7843014 AA and rs7460 TT homozygotes than in the respective rs7843014 C- (P = 0.016) and rs7460 A-allele (P = 0.009) carriers. These associations between muscle specific force and PTK2 SNPs suggest that interindividual differences exist in the way force is transmitted from the muscle fibers to the tendon. Therefore, our results demonstrate for the first time the impact of genetic variation on the intrinsic strength of human skeletal muscle.     

Identification of a role for the ARHGEF3 gene in postmenopausal osteoporosis

Osteoporosis is a common and debilitating bone disease characterized by low bone mineral density (BMD), a highly heritable and polygenic trait. Genome-wide linkage studies have identified 3p14-p21 as a quantitative trait locus for BMD. The ARHGEF3 gene is situated within this region and was identified as a strong positional candidate. The aim of this study was to evaluate the role of variation in ARHGEF3 on bone density in women. Sequence variation within ARHGEF3 was analyzed with 17 single-nucleotide polymorphisms (SNPs) in a discovery cohort of 769 female sibs. Significant associations were found with family-based association tests between five SNPs and various measures of age-adjusted BMD (p = 0.0007-0.041) with rs7646054 showing maximal association. Analysis of the data with QPDTPHASE suggested that the more common G allele at rs7646054 is associated with decreased age-adjusted BMD. Significant associations were also demonstrated between 3-SNP haplotypes and age-adjusted spine and femoral-neck BMD (p = 0.002 and 0.003, respectively). rs7646054 was then genotyped in a replication cohort, and significant associations with hip and spine BMD were confirmed (p = 0.003-0.038), as well as an association with fracture rate (p = 0.02). Again, the G allele was associated with a decrease in age-adjusted BMD at each site studied. In conclusion, genetic variation in ARHGEF3 plays a role in the determination of bone density in Caucasian women. This data implicates the RhoGTPase-RhoGEF pathway in osteoporosis.     

Variants of the ankyrin repeat domain 6 gene (ANKRD6) and muscle and physical activity phenotypes among European-derived American adults

Ankyrin repeat domain 6 (ANKRD6) is a ubiquitous protein that associates with early development in mammals and is highly expressed in the brain, spinal cord, and heart of humans. We examined the role of 8 ANKRD6 single-nucleotide polymorphisms (SNPs) on muscle performance and habitual physical activity (PA). Single-nucleotide polymorphisms were 545 T>A (rs9362667), 485 M>L (rs61736690), 233 T>M (rs2273238), 128 I>L (rs3748085), 631 P>L (rs61739327), 122 Q>E (rs16881983), 197805 G>A (rs9344950), and 710 L>X (NOVEL). This study consisted of 922 healthy, untrained, European-derived American men (n = 376, 23.6 ± 0.3 years, 25.0 ± 0.2 kg·m(-2)) and women (n = 546, 23.2 ± 0.2 years, 24.0 ± 0.2 kg·m(-2)). Muscle strength (maximum voluntary contraction [MVC] and 1 repetition maximum [1RM]) and size (cross-sectional area [CSA]) were assessed before and after 12 weeks of unilateral resistance training (RT). A subsample (n = 536, 23.4 ± 0.2 years, 24.6 ± 0.2 kg·m(-2)) completed the Paffenbarger Physical Activity Questionnaire. Associations among ANKRD6 genotypes and muscle phenotypes were tested with repeated measure analysis of covariance (ANCOVA) and PA phenotypes with multivariate ANCOVA, with age and body mass index as covariates. ANKRD6 122 Q>E was associated with increased baseline biceps CSA. ANKRD6 545 A>T and ANKRD6 710 L>X were associated with increased 1RM and MVC in response to RT, respectively. ANKRD6 631 P>L was associated with increased biceps CSA response to RT and time spent in moderate-intensity PA among the total sample and women. ANKRD6 genetic variants were associated with the muscle size and strength response to RT and habitual PA levels. Further research is needed to validate our results and explore mechanisms for the associations we observed.     

Polymorphisms in the NPY2R gene show significant associations with BMI that are additive to FTO, MC4R, and NPFFR2 gene effects

Neuropeptide Y (NPY) is an appetite hormone that acts centrally to control feeding behavior. The 5' and exon 2 regions of NPY2R, one of five NPY receptor genes, have been weakly and inconsistently implicated with obesity. With the ATG start site of the gene at the beginning of exon 2, single-nucleotide polymorphisms (SNPs) across intron 1 may show stronger associations with obesity than expected. Two 5' SNPs, three intron 1 SNPs, and one synonymous exon 2 SNP were genotyped on 2,985 white Utah subjects. Previously associated FTO, NPY, NPY1R, MC4R, PPARGC1A, OR7D4, and four NPFFR2 SNPs were also genotyped and related to BMI. One NPY2R 5' SNP (rs12649641, P = 0.008), an exon 2 SNP (rs2880415, P = 0.009), and an intron 1 SNP (rs17376826, P = 7 × 10(-6)) were each significantly associated with BMI. All three SNPs, plus FTO (rs9939609, P = 1.5 × 10(-6)) and two NPFFR2 SNPs (rs4129733, P = 3.7 × 10(-13) and rs11940196, 4.2 × 10(-10)) remained significant in a multiple regression additive model. Diplotypes using the estimated haplotypes of NPY2R, NPFFR2, and MC4R were significantly associated with BMI (P = 1.0 × 10(-10), 3.2 × 10(-8), and 1.1 × 10(-4), respectively). Haplotypes of NPY2R, NPFFR2, and MC4R, plus the FTO SNP, explained 9.6% of the BMI variance. SNP effect sizes per allele for the four genes ranged from 0.8 to 3.5 kg/m(2). We conclude that haplotypes containing the rs17376826 SNP in intron 1 of NPY2R have strong associations with BMI, some NPFFR2 haplotypes are strongly protective against or increase risk of obesity, and both NPY2R and NPFFR2 play important roles in obesity predisposition independent of FTO and MC4R.     

Further evidence for the role of ENPP1 in obesity: association with morbid obesity in Finns

The aim of this study was to investigate a series of single-nucleotide polymorphisms (SNPs) in the genes MC2R, MC3R, MC4R, MC5R, POMC, and ENPP1 for association with obesity. Twenty-five SNPs (2-7 SNPs/gene) were genotyped in 246 Finns with extreme obesity (BMI > or = 40 kg/m2) and in 481 lean subjects (BMI 20-25 kg/m2). Of the obese subjects, 23% had concomitant type 2 diabetes. SNPs and SNP haplotypes were tested for association with obesity and type 2 diabetes. Allele frequencies differed between obese and lean subjects for two SNPs in the ENPP1 gene, rs1800949 (P = 0.006) and rs943003 (P = 0.0009). These SNPs are part of a haplotype (rs1800949 C-rs943003 A), which was observed more frequently in lean subjects compared to obese subjects (P = 0.0007). Weaker associations were detected between the SNPs rs1541276 in the MC5R, rs1926065 in the MC3R genes and obesity (P = 0.04 and P = 0.03, respectively), and between SNPs rs2236700 in the MC5R, rs2118404 in the POMC, rs943003 in the ENPP1 genes and type 2 diabetes (P = 0.03, P = 0.02 and P = 0.02, respectively); these associations did not, however, remain significant after correction for multiple testing. In conclusion, a previously unexplored ENPP1 haplotype composed of SNPs rs1800949 and rs943003 showed suggestive evidence for association with adult-onset morbid obesity in Finns. In this study, we did not find association between the frequently studied ENPP1 K121Q variant, nor SNPs in the MCR or POMC genes and obesity or type 2 diabetes.     

Hepatocyte nuclear factor 4 alpha P2 promoter variants associate with insulin resistance

This study aimed to investigate the associations of hepatocyte nuclear factor 4 (HNF4) alpha single nucleotide polymorphisms (SNPs) and haplotype with insulin resistance and metabolic syndrome parameters. Nine SNPs spanning the HNF4 alpha P2 promoter (rs4810424, rs1884613 and rs1884614) and coding region (rs2144908, rs6031551, rs6031552, rs1885088, rs1028583 and rs3818247) were genotyped in 160 subjects without diabetes or metabolic syndrome. The HNF4 alpha P2 promoter SNPs rs4810424, rs1884613 and rs1884614 were associated with insulin resistance (p = 0.017; 0.037; 0.024) and body mass index (BMI) (p = 0.03; 0.035; 0.039). The intron 1D SNP rs2144908 was associated with high-density lipoprotein cholesterol (HDLc) (p = 0.020) and the intron 9 SNP rs3818247 showed association with systolic (p = 0.02) and diastolic (p = 0.034) blood pressure. HNF4 alpha common haplotype CCCGTC associated with higher insulin resistance (p = 0.022), fasting blood glucose (FBG) (p = 0.035) and lower HDLc (p = 0.001). In conclusion, subjects with HNF4 alpha P2 variants and haplotypes have been shown to have a higher insulin resistance and are therefore at a higher risk for developing type 2 diabetes mellitus.     

Evidence for statistical epistasis between catechol-<Emphasis Type="Italic">O</Emphasis>-methyltransferase (COMT) and polymorphisms in RGS4, G72 (DAOA), GRM3, and DISC1: influence on risk of schizophrenia

Catechol-O-methyltransferase (COMT) regulates dopamine degradation and is located in a genomic region that is deleted in a syndrome associated with psychosis, making it a promising candidate gene for schizophrenia. COMT also has been shown to influence prefrontal cortex processing efficiency. Prefrontal processing dysfunction is a common finding in schizophrenia, and a background of inefficient processing may modulate the effect of other candidate genes. Using the NIMH sibling study (SS), a non-independent case-control set, and an independent German (G) case-control set, we performed conditional/unconditional logistic regression to test for epistasis between SNPs in COMT (rs2097603, Val158Met (rs4680), rs165599) and polymorphisms in other schizophrenia susceptibility genes. Evidence for interaction was evaluated using a likelihood ratio test (LRT) between nested models. SNPs in RGS4, G72, GRM3, and DISC1 showed evidence for significant statistical epistasis with COMT. A striking result was found in RGS4: three of five SNPs showed a significant increase in risk [LRT P-values: 90387 = 0.05 (SS); SNP4 = 0.02 (SS), 0.02 (G); SNP18 = 0.04 (SS), 0.008 (G)] in interaction with COMT; main effects for RGS4 SNPs were null. Significant results for SNP4 and SNP18 were also found in the German study. We were able to detect statistical interaction between COMT and polymorphisms in candidate genes for schizophrenia, many of which had no significant main effect. In addition, we were able to replicate other studies, including allelic directionality. The use of epistatic models may improve replication of psychiatric candidate gene studies.     

Identification of single nucleotide polymorphisms in the bovine CCL2, IL8, CCR2 and IL8RA genes and their association with health and production in Canadian Holsteins

The aim of this study was to identify the presence of SNPs in the chemokine genes CCL2 and IL8 and the chemokine receptor genes IL8RA and CCR2, and assess their potential contribution to variation in estimated breeding values (EBVs) for somatic cell score (SCS) and four other traits in Canadian Holstein bulls. Pools of DNA for bulls with high (H) and low (L) EBVs for SCS were used for identification of 11 SNPs. Two unreported SNPs were found in the CCL2 gene and one SNP was found in the CCR2 gene. Previously reported SNPs (three in the IL8 gene and five in the IL8RA chemokine receptor) were also identified. Two SNPs in CCL2, three in IL8, one in IL8RA and one in CCR2 were genotyped in Canadian Holstein bulls (n = 338) using tetra primer ARMS-PCR. We investigated associations of these seven polymorphisms with three production traits (milk yield, fat yield and protein yield) and one conformation trait related to mastitis (udder depth). The allele substitution effect for the CCL2 rs41255713:T>C SNP was significant at an experimental-wise level for milk yield (247.5 +/- 79.9 kg) and protein yield (7.4 +/- 2.3 kg) EBVs (P T SNP on SCS was significant at the comparison-wise level (-0.04 +/- 0.02, P = 0.05), which might indicate a possible association in support of other published studies. Lastly, we assigned CCR2 to BTA22q24, where a previously QTL for SCS was identified.     

Multiple common susceptibility variants near BMP pathway loci GREM1, BMP4, and BMP2 explain part of the missing heritability of colorectal cancer

Genome-wide association studies (GWAS) have identified 14 tagging single nucleotide polymorphisms (tagSNPs) that are associated with the risk of colorectal cancer (CRC), and several of these tagSNPs are near bone morphogenetic protein (BMP) pathway loci. The penalty of multiple testing implicit in GWAS increases the attraction of complementary approaches for disease gene discovery, including candidate gene- or pathway-based analyses. The strongest candidate loci for additional predisposition SNPs are arguably those already known both to have functional relevance and to be involved in disease risk. To investigate this proposition, we searched for novel CRC susceptibility variants close to the BMP pathway genes GREM1 (15q13.3), BMP4 (14q22.2), and BMP2 (20p12.3) using sample sets totalling 24,910 CRC cases and 26,275 controls. We identified new, independent CRC predisposition SNPs close to BMP4 (rs1957636, P = 3.93×10(-10)) and BMP2 (rs4813802, P = 4.65×10(-11)). Near GREM1, we found using fine-mapping that the previously-identified association between tagSNP rs4779584 and CRC actually resulted from two independent signals represented by rs16969681 (P = 5.33×10(-8)) and rs11632715 (P = 2.30×10(-10)). As low-penetrance predisposition variants become harder to identify-owing to small effect sizes and/or low risk allele frequencies-approaches based on informed candidate gene selection may become increasingly attractive. Our data emphasise that genetic fine-mapping studies can deconvolute associations that have arisen owing to independent correlation of a tagSNP with more than one functional SNP, thus explaining some of the apparently missing heritability of common diseases.     

Complement receptor 1 gene variants are associated with erythrocyte sedimentation rate

The erythrocyte sedimentation rate (ESR), a commonly performed test of the acute phase response, is the rate at which erythrocytes sediment in vitro in 1 hr. The molecular basis of erythrocyte sedimentation is unknown. To identify genetic variants associated with ESR, we carried out a genome-wide association study of 7607 patients in the Electronic Medical Records and Genomics (eMERGE) network. The discovery cohort consisted of 1979 individuals from the Mayo Clinic, and the replication cohort consisted of 5628 individuals from the remaining four eMERGE sites. A nonsynonymous SNP, rs6691117 (Val→IIe), in the complement receptor 1 gene (CR1) was associated with ESR (discovery cohort p = 7 × 10(-12), replication cohort p = 3 × 10(-14), combined cohort p = 9 × 10(-24)). We imputed 61 SNPs in CR1, and a "possibly damaging" SNP (rs2274567, His→Arg) in linkage disequilibrium (r(2) = 0.74) with rs6691117 was also associated with ESR (discovery p = 5 × 10(-11), replication p = 7 × 10(-17), and combined cohort p = 2 × 10(-25)). The two nonsynonymous SNPs in CR1 are near the C3b/C4b binding site, suggesting a possible mechanism by which the variants may influence ESR. In conclusion, genetic variation in CR1, which encodes a protein that clears complement-tagged inflammatory particles from the circulation, influences interindividual variation in ESR, highlighting an association between the innate immunity pathway and erythrocyte interactions.     

Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women

Body fat distribution, particularly centralized obesity, is associated with metabolic risk above and beyond total adiposity. We performed genome-wide association of abdominal adipose depots quantified using computed tomography (CT) to uncover novel loci for body fat distribution among participants of European ancestry. Subcutaneous and visceral fat were quantified in 5,560 women and 4,997 men from 4 population-based studies. Genome-wide genotyping was performed using standard arrays and imputed to ~2.5 million Hapmap SNPs. Each study performed a genome-wide association analysis of subcutaneous adipose tissue (SAT), visceral adipose tissue (VAT), VAT adjusted for body mass index, and VAT/SAT ratio (a metric of the propensity to store fat viscerally as compared to subcutaneously) in the overall sample and in women and men separately. A weighted z-score meta-analysis was conducted. For the VAT/SAT ratio, our most significant p-value was rs11118316 at LYPLAL1 gene (p = 3.1 × 10E-09), previously identified in association with waist-hip ratio. For SAT, the most significant SNP was in the FTO gene (p = 5.9 × 10E-08). Given the known gender differences in body fat distribution, we performed sex-specific analyses. Our most significant finding was for VAT in women, rs1659258 near THNSL2 (p = 1.6 × 10-08), but not men (p = 0.75). Validation of this SNP in the GIANT consortium data demonstrated a similar sex-specific pattern, with observed significance in women (p = 0.006) but not men (p = 0.24) for BMI and waist circumference (p = 0.04 [women], p = 0.49 [men]). Finally, we interrogated our data for the 14 recently published loci for body fat distribution (measured by waist-hip ratio adjusted for BMI); associations were observed at 7 of these loci. In contrast, we observed associations at only 7/32 loci previously identified in association with BMI; the majority of overlap was observed with SAT. Genome-wide association for visceral and subcutaneous fat revealed a SNP for VAT in women. More refined phenotypes for body composition and fat distribution can detect new loci not previously uncovered in large-scale GWAS of anthropometric traits.     

Association study of CRP gene polymorphisms with serum CRP level and cardiovascular risk in the NHLBI Family Heart Study

Recent epidemiological studies have indicated that baseline C-reactive protein (CRP) levels may have value in prediction of cardiovascular risk. Using six tag single-nucleotide polymorphisms (SNPs) selected from our complete list of SNPs on the CRP gene, we investigated the association of CRP genotypes with plasma CRP levels and cardiovascular risk in the National Heart, Lung, and Blood Institute (NHLBI) Family Heart Study cohort (1,296 Caucasians, 48.5% male, 54.7 +/- 12.8 yr old). There was a significant trend toward association of CRP haplotypes with CRP levels (P = 0.045). SNP analysis indicated a highly significant association of SNP -757 (rs3093059, P = 0.0004) and SNP -286 (rs3091244, P = 0.0065) and a borderline association of SNP -7180 (rs1341665, P = 0.06) with CRP levels. Neither CRP haplotypes nor individual SNP genotypes were associated with intima-media thickness of the common carotid or internal carotid artery or the bifurcation of the carotid arteries. These results indicated a strong impact of local SNPs of the CRP gene on plasma CRP levels, but there was no direct evidence that these genetically controlled CRP elevations by local CRP SNPs contributed to cardiovascular disease phenotypes.     

Association study involving polymorphisms in IL-6, IL-1RA,and CTLA4 genes and rheumatic heart disease in New Zealand population of Māori and Pacific ancestry

IntroductionRheumatic fever (RF) incidence among New Zealand (NZ) individuals of Polynesian (Māori and Pacific) ancestry remains among the highest in the world. Polymorphisms in the IL-6, IL1RN, and CTLA4 genes have been associated with RF, and their products are modulated by new medications. Confirmation of these previous associations could help guide clinical approaches. We aimed to test IL-6, IL-1RA (IL1RN), and CTLA4 functional SNPs in 204 rheumatic heart disease (RHD) patients and 116 controls of Māori and Pacific ancestry.Material and methodSelf-reported ancestry of the eight great-grandparents defined ancestry of participants. Severity of carditis was classified according to the 2012 World Heart Federation guideline for the echocardiographic diagnosis of RHD. The IL-6 promoter rs1800797, IL1RN rs447713 and CTLA4 rs3087243 SNPs were genotyped by Taqman. Correlations were assessed by logistic regression analysis adjusting for gender and ancestry.ResultsThe IL-6 rs1800797 variant was significantly associated with RHD with carriers of the GG genotype 6.09 (CI 1.23; 30.23) times more likely to develop RHD than the carriers of the AA genotype (P = 0.027). No significant associations with RHD were found for the IL1RN rs447713 and CTLA4 rs3087243 SNPs. Patients carrying the G allele (GG plus AG genotype) for the IL1RN rs447713 SNP had 2.36 times (CI 1.00; 5.56) more severe carditis than those without this allele (the AA genotype) (P = 0.049).ConclusionThe IL-6 promoter rs1800797 (−597G/A) SNP may influence susceptibility to RHD of people of Māori and Pacific ancestry living in NZ. The IL1RN rs447713 SNP may influence the severity of carditis in this population.     

Genetic analysis of innate immunity in Crohn's disease and ulcerative colitis identifies two susceptibility loci harboring CARD9 and IL18RAP

The two main phenotypes of inflammatory bowel disease (IBD)--Crohn's disease (CD) and ulcerative colitis (UC)--are chronic intestinal inflammatory disorders with a complex genetic background. Using a three-stage design, we performed a functional candidate-gene analysis of innate immune pathway in IBD. In phase I, we typed 354 SNPs from 85 innate immunity genes in 520 Dutch IBD patients (284 CD, 236 UC) and 808 controls. In phase II, ten autosomal SNPs showing association at p < 0.006 in phase I were replicated in a second cohort of 545 IBD patients (326 CD, 219 UC) and 360 controls. In phase III, four SNPs with p < 0.01 in the combined phase I and phase II analysis were genotyped in an additional 786 IBD samples (452 CD, 334 UC) and 768 independent controls. Joint analysis of 1851 IBD patients (1062 CD, 789 UC) and 1936 controls demonstrated strong association to the IL18RAP rs917997 SNP for both CD and UC (p(IBD) 1.9 x 10(-8); OR 1.35). Association in CD is independently supported by the Crohn's disease dataset of the Wellcome Trust Case Control Consortium (imputed SNP rs917997, p = 9.19 x 10(-4)). In addition, an association of the CARD9 rs10870077 SNP to CD and UC was observed (p(IBD) = 3.25 x 10(-5); OR 1.21). Both genes are located in extended haplotype blocks on 2q11-2q12 and 9q34.3, respectively. Our results indicate two IBD loci and further support the importance of the innate immune system in the predisposition to both CD and UC.     

Identification of PLCL1 gene for hip bone size variation in females in a genome-wide association study

Osteoporosis, the most prevalent metabolic bone disease among older people, increases risk for low trauma hip fractures (HF) that are associated with high morbidity and mortality. Hip bone size (BS) has been identified as one of the key measurable risk factors for HF. Although hip BS is highly genetically determined, genetic factors underlying the trait are still poorly defined. Here, we performed the first genome-wide association study (GWAS) of hip BS interrogating approximately 380,000 SNPs on the Affymetrix platform in 1,000 homogeneous unrelated Caucasian subjects, including 501 females and 499 males. We identified a gene, PLCL1 (phospholipase c-like 1), that had four SNPs associated with hip BS at, or approaching, a genome-wide significance level in our female subjects; the most significant SNP, rs7595412, achieved a p value of 3.72x10(-7). The gene's importance to hip BS was replicated using the Illumina genotyping platform in an independent UK cohort containing 1,216 Caucasian females. Two SNPs of the PLCL1 gene, rs892515 and rs9789480, surrounded by the four SNPs identified in our GWAS, achieved p values of 8.62x10(-3) and 2.44x10(-3), respectively, for association with hip BS. Imputation analyses on our GWAS and the UK samples further confirmed the replication signals; eight SNPs of the gene achieved combined imputed p values<10(-5) in the two samples. The PLCL1 gene's relevance to HF was also observed in a Chinese sample containing 403 females, including 266 with HF and 177 control subjects. A SNP of the PLCL1 gene, rs3771362 that is only approximately 0.6 kb apart from the most significant SNP detected in our GWAS (rs7595412), achieved a p value of 7.66x10(-3) (odds ratio = 0.26) for association with HF. Additional biological support for the role of PLCL1 in BS comes from previous demonstrations that the PLCL1 protein inhibits IP3 (inositol 1,4,5-trisphosphate)-mediated calcium signaling, an important pathway regulating mechanical sensing of bone cells. Our findings suggest that PLCL1 is a novel gene associated with variation in hip BS, and provide new insights into the pathogenesis of HF.     

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.