Vegetative Incompatibility Among Monoconidial Isolates of <Emphasis Type="Italic">Bipolaris sorokiniana</Emphasis>

Bipolaris sorokiniana is a phytopathogenic fungus that causes diseases of cereal crops, such as leaf-spot disease, common root rot, and black point of grain. Because of its great morphological, physiological, and genetic variability, this fungus is difficult to control. The aim of this investigation was to study the variability of isolates of B. sorokiniana by means of vegetative incompatibility. Thirty-five isolates of B. sorokiniana from different geographical regions in Brazil and other countries were used. The vegetative incompatibility between the isolates and the influences of different culture media on these reactions were evaluated. The total protein profile of the isolates was analyzed when the isolates were cultured separately, and in cultures of compatibility and incompatibility reactions. Eighteen of 31 confrontations showed vegetative incompatibility. The results obtained with different culture media for the vegetative compatibility/incompatibility genotypes suggested that the type of substratum influences these reactions. No differences in protein profiles among the isolates were observed. This result suggests that there is no induction of expression of different proteins in vegetative incompatibility reactions.     

Restriction analysis of the amplified ribosomal DNA spacers ITS1 and ITS2 of <Emphasis Type="Italic">Bipolaris sorokiniana</Emphasis> isolates

The purpose of this study was to examine the genotypic variability of Bipolaris sorokiniana by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis using rDNA. Fifty B. sorokiniana isolates from Brazil and other countries, one Bipolaris oryzae and six Drechslera teres isolates were used. The intragenic spacer regions (ITS1 and ITS2) were the regions used for characterization of isolates. The amplification products for both ITS regions, showed two DNA fragments for all isolates. Two B. sorokiniana isolates presented an intraspecific variability showing a third fragment for the ITS1 region. The dendrograms generated with PCR-RFLP data showed intra- and inter-specific groups. The dendrograms showed that most of Brazilian isolates clustered together forming groups between them, and this behavior was repeated with most isolates from other countries. The dendrograms did not enable the separation of B. sorokiniana isolates by their geographic origin or host type. These results suggest the occurrence of gene flow between different populations of the fungus isolated in geographically distant regions and lends cogency to the occurrence of gene flow between species.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Influence of Seed‐borne Cochliobolus sativus (Anamorph Bipolaris sorokiniana) on Crown Rot and Root Rot of Barley and Wheat

The effect of seed‐borne pathogens of wheat and barley on crown and root rot diseases of seven barley cultivars (Jimah‐6, Jimah‐51, Jimah‐54, Jimah‐58, Omani, Beecher and Duraqi) and three wheat cultivars (Cooley, Maissani and Shawarir) was investigated. Bipolaris sorokiniana and Alternaria alternata were detected in seeds of at least eight cultivars, but Fusarium species in seeds of only two barley cultivars (Jimah‐54 and Jimah‐58). Crown rot and root rot symptoms developed on barley and wheat cultivars following germination of infected seeds in sterilized growing media. Bipolaris sorokiniana was the only pathogen consistently isolated from crowns and roots of the emerging seedlings. In addition, crown rot and root rot diseases of non‐inoculated barley cultivars correlated significantly with B. sorokiniana inoculum in seeds (P = 0.0019), but not with Fusarium or Alternaria (P > 0.05). These results indicate the role of seed‐borne inoculum of B. sorokiniana in development of crown rot and root rot diseases. Pathogenicity tests of B. sorokiniana isolates confirmed its role in inducing crown rot and root rot, with two wheat cultivars being more resistant to crown and root rots than most barley cultivars (P < 0.05). Barley cultivars also exhibited significant differences in resistance to crown rot (P < 0.05). In addition, black point disease symptoms were observed on seeds of three barley cultivars and were found to significantly affect seed germination and growth of some of these cultivars. This study confirms the role of seed‐borne inoculum of B. sorokiniana in crown and root rots of wheat and barley and is the first report in Oman of the association of B. sorokiniana with black point disease of barley.     

Clonal Variability and Its Relevance in Generation of New Pathotypes in the Spot Blotch Pathogen, <Emphasis Type="Italic">Bipolaris sorokiniana</Emphasis>

Spot blotch pathogen Bipolaris sorokiniana of wheat was investigated with threefold objectives: to establish a relationship between morphological and pathological variability of isolates, identify clonal genotype(s) acting as a source for the generation of new variability, and to determine the mechanism of generation of such variability in the pathogen. Isolates were collected from the leaves and seeds of field-grown wheat crop at four different sites in eastern Gangetic plains of India. Eighty-six clonal isolates derived from a single isolate (gray with white patches, Group III), which segregated in an equal proportion of parental and nonparental types, were studied. Morphological characters—i.e., colony morphology, growth rate, and sporulation—were studied along with disease-causing ability of the isolate clones. Clonal isolates were grouped into three categories. Microscopic analysis of nuclei was done to determine the causes of such variability. Morphological variability appeared to be related to the pathological variability. The isolate having epidemic potential appeared different than that acting as the reservoir for variability. The cause of such variability could be attributed either to hyphal fusion and heterokaryosis, nuclear migration and occurrence of multinucleate state, or a combination of these factors. Random Amplified Polymorphic DNA (RAPD) assay suggested that the unique fragments for different groups could be utilized as molecular markers to identify the isolates of specific groups.     

Isolation of Eutypa lata from Juglans regia, and Pathogenicity Studies on Different Wood Plants

The fungus Eutypa lata was isolated from diseased walnut trees (Juglans regia) exhibiting small cankers. The morphological characteristics of the culture and the pathogenicity were compared with those of known isolates of the fungus from other hosts. Inoculation tests with walnut isolates on grape, walnut, almond and apricot yielded characteristic cankers. Furthermore, pathogenicity tests on walnut with isolates from other different hosts resulted in differences in virulence. Similar differences in virulence were observed between 13 single ascospore isolates of the fungus ex apricot inoculated on walnut.     

Genetic Diversity Among Monoconidial and Polyconidial Isolates of Bipolaris sorokiniana

Spot blotch caused by Bipolaris sorokiniana is a destructive disease of wheat in warm and humid wheat-growing regions of the world. This fungus shows a high genetic diversity and morphological and physiologic variability. In this study, 19 polysporic and 57 monosporic isolates of B. sorokiniana were characterized using universal rice primers—URP-PCR. The results obtained when the dendrogram was constructed with all the data produced with the amplification products showed very distinct clusters. However, the similarity among the isolates was low where 37 and 26.3 % of the monosporic and polysporic isolates, respectively, showed similarity above 70 %. All primers amplified multiple DNA fragments of polysporic as well as the monosporic isolates. Isolates fingerprints were constructed based on binary characters revealed by the three primers. An amplified fragment of approximately 750 bp was observed among 40 % of the isolates, when primer URP-1F was used. When primers URP-4R and URP-2R were used, a fragment of 450 and 400 bp was present in 31.5 and 29 % of the isolates, respectively. It was expected a higher similarity among the isolates since the monosporic cultures were originated from the polysporic. The dendrogram did not enable the separation of B. sorokiniana isolates by their geographic origin. This low correlation suggests that gene transfer may have occurred by parasexual combination in this fungus population. However, in spite of the research efforts for that end, it has not been possible to establish patterns that characterize the profile of B. sorokiniana.     

Genetic Characterization and Pathogenicity of Rhizoctonia solani Associated with Common Bean Web Blight in the Main Bean Growing area of Argentina

Common bean web blight (WB), caused by the fungus Rhizoctonia solani (teleomorph Thanatephorus cucumeris), is among the endemic fungal diseases of major impact in north‐western Argentina (NWA). This study aimed to analyse the genetic and pathogenic diversity of R. solani in Salta, NWA, where 97 isolates were recovered from commercial bean cultivars and wild beans showing WB symptoms in a major bean production area. The isolates were characterized on the basis of specific primers, rDNA‐ITS sequences and morphological characteristics. All the isolates were identified as R. solani AG 2‐2WB, and they exhibited considerable intragroup variation. The phylogenetic tree generated with the ITS sequences confirmed the isolates identification. Aggressiveness of the isolates towards bean seedlings was assessed in the greenhouse. A great variability in virulence was observed among the isolates analysed. On the basis of the disease reaction on foliar tissues, the isolates were grouped into three virulence categories as follows: weakly virulent (30%), moderately virulent (38%) and highly virulent (32%). However, no correlation between virulence and geographical origin was detected. The information generated in this study provides initial data on the population variability of the WB pathogen in north‐western Argentina and represents a valuable contribution to regional breeding programmes aimed to obtain cultivars with durable resistance.     

The discovery of the virulence gene ToxA in the wheat and barley pathogen Bipolaris sorokiniana

Bipolaris sorokiniana is the causal agent of multiple diseases on wheat and barley and is the primary constraint to cereal production throughout South Asia. Despite its significance, the molecular basis of disease is poorly understood. To address this, the genomes of three Australian isolates of B. sorokiniana were sequenced and screened for known pathogenicity genes. Sequence analysis revealed that the isolate BRIP10943 harboured the ToxA gene, which has been associated previously with disease in the wheat pathogens Parastagonospora nodorum and Pyrenophora tritici‐repentis. Analysis of the regions flanking ToxA within B. sorokiniana revealed that it was embedded within a 12‐kb genomic element nearly identical to the corresponding regions in P. nodorum and P. tritici‐repentis. A screen of 35 Australian B. sorokiniana isolates confirmed that ToxA was present in 12 isolates. Sequencing of the ToxA genes within these isolates revealed two haplotypes, which differed by a single non‐synonymous nucleotide substitution. Pathogenicity assays showed that a B. sorokiniana isolate harbouring ToxA was more virulent on wheat lines that contained the sensitivity gene when compared with a non‐ToxA isolate. This work demonstrates that proteins that confer host‐specific virulence can be horizontally acquired across multiple species. This acquisition can dramatically increase the virulence of pathogenic strains on susceptible cultivars, which, in an agricultural setting, can have devastating economic and social impacts.     

Esterase electrophoretic analysis to distinguish isolates between Bipolaris spp. and Drechslera tritici-repentis from wheat

Diseases caused in wheat by Bipolaris sorokiniana and Drechslera tritici-repentis have led to considerable yield and production losses. In wheat seeds another isolate has recently been identified, resembling Bipolaris bicolor. The objective of the present trial was to differentiate and identify isolates of these fungi based on electrophoretic analyses and morphology. Esterase electrophoresis enabled the differentiation between Drechslera sp. and Bipolaris sp. isolates. In relation to morphology, conidia from D. tritici-repentis isolates were significantly longer than the isolates of B. sorokiniana. Bipolaris bicolor isolates, on the other hand, presented wider conidia than those of D. tritici-repentis and B. sorokiniana.     

Biology of <Emphasis Type="Italic">B. sorokiniana</Emphasis> (syn. <Emphasis Type="Italic">Cochliobolus sativus</Emphasis>) in genomics era

Bipolaris sorokiniana (Sacc.) Shoemaker is a hemi-biotrophic fungal pathogen, which is an anamorph (teleomorph Cochlibolus sativus). It causes spot blotch, root rot and leaf spot diseases in a number of cereals including wheat, barley and other small grain cereals. In the genomics era, the fungus has been subjected to a variety of studies using molecular approaches. Correct chromosome number was determined and molecular karyotypes were prepared using contour-clamped homogeneous electric field. Molecular maps were prepared using markers like RFLPs, SSRs, RAPDs and SNPs. For this purpose, segregating progenies derived from crosses between diverse isolates of the pathogen were used. Whole genome sequencing (WGS) data was collected not only for B. sorokiniana isolates, but also for several species of Cochliobolus. Genes involved in secondary metabolism and virulence were identified from genome sequences. The WGS data has also been utilized for comparative genomics giving useful information about evolutionary trends. A brief account of this information is presented in this review.     

<i>Streptomyces</i> PRIO41 as plant growth promoter of jalapeño pepper plants and as biocontrol agent of <i>Fusarium</i>

Chili pepper is one of the main crops of economic importance in Mexico, and Fusarium wilting is a disease that limits its production. In addition, the inappropriate use of agrochemicals in farming activities generate environmental and health problems. Therefore, in this study the effectiveness of Streptomyces sp PRIO41 was evaluated as a (1) biocontrol agent of Fusarium spp and (2) plant growth promoter bacteria. Assays of pathogenicity and virulence of Fusarium spp. in jalapeño pepper seeds, and interactions of these pathogens with Streptomyces PRIO41 were evaluated under two nutritional conditions. In the greenhouse, the effectiveness of Streptomyces sp. PRIO41 was determined as a (1) biocontrol of Fusarium, and (2) plant growth promoter of wilt of pepper plants. The results showed that all fungal isolates caused symptoms in pepper seeds and seedlings with different degrees of virulence. Interactions in vitro showed that Streptomyces showed the most effective range of virulence against Fusarium isolates in the poor medium (37.6%-100%), with fungicidal effects in some cases. In the greenhouse, Streptomyces PRIO41 reduced Fusarium wilting up to a 40%, and positively affected all vegetative growth parameters, particularly plant height, leaf area, root length, and leaf and root dry biomasses. This study showed the potential of Streptomyces PRIO41 as a biocontrol agent of Fusarium spp., and as a biofertilizer of pepper plants.     

Effects of temperature and water activity on <Emphasis Type="Italic">Lecanicillium</Emphasis> spp. conidia germination and growth,and mycosis of <Emphasis Type="Italic">Pissodes strobi</Emphasis>

Selecting entomopathogenic fungal isolates for use as biocontrol agents requires an assessment of their growth and virulence characteristics as affected by environmental conditions. Here we demonstrate a wide temperature and moisture range for colony growth, effective conidial germination and virulence against Pissodes strobi Peck (white pine weevil) of several isolates of Lecanicillium Gams and Zare, an entomopathogenic fungus distributed worldwide and indigenous to forests on Vancouver Island, British Columbia, Canada. In order to examine the potential Lecanicillium as a biological control agent, the pathogenicity of isolates collected from different geographical locations on P. strobi cadavers was assessed, and colony growth at different temperatures was evaluated. Colony growth was evident between 5 and 30°C, with optimal growth occurring at 25°C. Various combinations of water activity (0.55, 0.76, 0.85 and 0.99 a _w) and temperature (10, 15, 20, and 25°C) were also used to evaluate environmental impacts on conidial germination and cumulative mycosis of adult P. strobi. Certain Lecanicillium isolates displayed xerophilic (0.85 a _w) or psychrophilic (10°C) growth optima. Ultimately, identifying the abiotic limits of this entomopathogenic fungus will be used to determine which isolates have potential for future in situ biocontrol trials.     

The potential of antagonistic moroccan Streptomyces isolates for the biological control of damping‐off disease of pea (Pisum sativum L.) caused by Aphanomyces euteiches

Three hundred and fifty‐nine isolates of actinobacteria collected from different Moroccan soils were evaluated for their in vitro antimicrobial activity against the oomycete pathogen Aphanomyces euteiches, the causal agent of damping‐off of pea and other legumes. Eighty‐seven isolates (24%) had an inhibitory in vitro effect against A. euteiches. Fourteen bioactive isolates with the greatest inhibitory effect against A. euteiches and no inhibitory effect on plant beneficial rhizobia were tested for their ability to protect pea seeds and seedlings against the damping‐off disease using culture supernatants or spore suspensions as treatments. The two most protective isolates, OB21 and BA15, significantly reduced, compared to untreated control plants, damping‐off by 33% and 47%, respectively. The two bioactive isolates were classified as species of the genus Streptomyces based on 16S rDNA analysis and morphological and chemical characteristics.     

Morphological,pathological and molecular characterisation of rice sheath blight disease causal organism Rhizoctonia solani AG-1 IA in Egypt

Rice sheath blight disease caused by Rhizoctonia solani is considered a distractive soil-borne disease of rice production worldwide. The study aimed to determine the causal organism of sheath blight symptoms in Egyptian rice fields. Sheath blight symptoms were first observed in a small area during 2013, 2014 and 2016 seasons, later in a wide area of rice fields in 2016 to 2018 seasons. Pathogen identification was carried out based on morphological traits and internal transcribed spacer sequencing. Thirty-six isolates were identified as R. solani fungus. The isolates exhibited a wide range of variability in their morphological traits and virulence patterns. Five isolates were sequenced and aligned with Chinese isolates with 75–100% identity. This is the first report of R. solani AG-1 IA that associated with rice sheath blight in Egypt. Initiate a breeding program for disease resistance and integrated disease management procedures are important to keep the disease under control.     

Susceptibility of different life stages of the European cherry fruit fly,Rhagoletis cerasi,to entomopathogenic fungi

The effects of six fungus isolates on the mortality of different life stages of the European cherry fruit fly, Rhagoletis cerasi (Diptera: Tephritidae), were assessed in a series of laboratory experiments to find an isolate suitable for biological control. In a first step, the effects of fungus treatments on mortality, mycosis and fecundity of adult flies at a concentration of 10⁷ conidia/ml were evaluated. All fungus isolates caused mycosis but virulence varied considerably among the isolates. Beauveria bassiana and Isaria fumosorosea caused 90–100% mortality and had the strongest influence on fecundity. Metarhizium anisopliae also induced high rates of mortality, while the pathogenicity of Isaria farinosa was low. The effects of lower conidia concentrations and the influence of the age of flies were assessed in a second step. Higher conidia concentrations generally resulted in a higher mortality. B. bassiana was most efficient at low concentrations. Young flies showed lower mortality rates than older flies but, sub‐lethal effects on eclosion rate of eggs were greater in younger flies. Finally, the effects on L₃ larvae were tested: none of the fungus isolates induced mortality in more than 25% of larvae. As L₃ larvae and pupae are not susceptible to fungus infection, field control of R. cerasi should be focused on adult flies.     

Isolation,evaluation and characterization of <Emphasis Type="Italic">Bacillus subtilis</Emphasis> from cotton rhizospheric soil with biocontrol activity against <Emphasis Type="Italic">Fusarium oxysporum</Emphasis>

Present investigation is based on the isolation of Bacillus subtilis from cotton rhizosphere and their evaluation as biocontrol agent against Fusarium oxysporum. The production of extracellular hydrolytic enzyme was studied for determining the antagonism. 43% of 21 isolates were identified under the B. subtilis group on the basis of biochemical characterization. 38% isolates showed competitive activity against Fusarium oxysporum and exhibit more than 50% mycelial inhibition in dual culture bioassay. The pot assay of cotton by seed treatment and soil amendment technique under green house condition showed the competent activity of the isolates in preventing the wilting of cotton seedlings due to F. oxysporum infection. SVI values of 30 day old seedlings indicated that the soil inoculation with B. subtilis BP-2 and seed treatment with B. subtilis BP-9 significantly promoted the growth of cotton seedlings. RAPD profiling revealed the diversity in the Bacillus subtilis group, ranging from 10 to 32%. The discriminative pattern among the isolates belonging to the same species was validated by 16S rDNA partial sequencing which identified them into four different strains of B. subtilis.     

Phytase,Phosphatase Activity and P-Nutrition of Soybean as Influenced by Inoculation of <Emphasis Type="Italic">Bacillus</Emphasis>

The efficiency of different Bacillus isolates on rhizosphere soil enzyme activities and P-nutrition of soybean was carried out under microcosm conditions. Significant increase in enzyme activities viz., fluorescein diacetate activity, phosphatase and phytase activity and consequent effects on P-nutrition were observed with the inoculation of Bacillus isolates over uninoculated control. Among the isolates, BD-3-1B, KHBD-6, BDKH-3, Bacillus amyloliquefacians, and Bacillus cereus were found to be promising. The phytic acid-P as a percentage of total P content in soybean seeds decreased with the inoculation of Bacillus isolates as compared to un-inoculated control. A decrease in phytic-P in soybean seeds not only results in better digestibility and increased feed efficiency. Pearson correlation studies revealed a significant positive association between acid, alkaline phosphatases, phytase activity on available P content in soil and P content in seeds with the inoculation of Bacillus isolates, indicating role of these enzymes in P mobilization and acquisition by soybean.     

Genetic diversity and plant-growth related features of <Emphasis Type="Italic">Burkholderia</Emphasis> spp. from sugarcane roots

Brazil is the largest sugarcane producer in the world, mainly due to the development of different management strategies. Recently, microbial-plant related studies revealed that bacterial isolates belonging to the genus Burkholderia are mainly associated with this plant and are responsible for a range of physiological activity. In this study, we properly evaluate the physiological activity and genetic diversity of endophytic and rhizospheric Burkholderia spp. isolates from sugarcane roots grown in the field in Brazil. In total, 39 isolates previously identified as Burkholderia spp. were firstly evaluated for the capability to fix nitrogen, produce siderophores, solubilise inorganic phosphates, produce indole-acetic acid and inhibit sugarcane phytopathogens in vitro. These results revealed that all isolates present at least two positive evaluated activities. Furthermore, a phylogenetic study was carried out using 16S rRNA and gyrB genes revealing that most of the isolates were affiliated with the Burkholderia cepacia complex. Hence, a clear separation given by endophytic or rhizospheric niche occupation was not observed. These results presented an overview about Burkholderia spp. isolates from sugarcane roots and supply information about the physiological activity and genetic diversity of this genus, given direction for further studies related to achieve more sustainable cultivation of sugarcane.     

Mycoviruses of Botrytis cinerea isolates from different hosts

Botrytis cinerea (teleomorph Botryotinia fuckeliana) is a necrotrophic plant pathogenic fungus that causes grey mould and enormous economic losses worldwide in different crops. Control of B. cinerea is difficult due to the appearance of fungicide‐resistant isolates, and the diversity in virulence due to genetic variability and, perhaps, the infection with mycoviruses or fungal viruses. The discovery of mycoviruses and their possible application as biocontrol agents, as well as their use as tools to study the plant–pathogen interaction, has encouraged their study in B. cinerea. Herein, we have analysed the occurrence of mycoviruses in Spanish B. cinerea isolates to approach a better understanding of the interactions among viruses, fungi and plants in this pathosystem. Fifty‐five percent of the B. cinerea isolates analysed contained double‐stranded RNA (dsRNA) elements, and the number of dsRNA elements, their relative concentration and size were variable among isolates. Some of these dsRNAs were related to the presence of virus like rod or isometric particles, and to cellular degeneration and malformed mitochondria. We have also demonstrated that a 3 kb dsRNA present in 55% of the isolates having dsRNA elements was a mycovirus genome. Partial sequence of that mycovirus presented high identity in nucleotide and amino acid sequence with Botrytis cinerea mitovirus 1 (BcMV1). Analysis of the genetic distance within Spanish BcMV1 sequences showed the existence of different isolates of this mitovirus inside the Spanish B. cinerea population analysed. This is the first report of the variability of dsRNA elements and the partial genome sequence of a mitovirus associated with Spanish B. cinerea isolates and the genetic diversity within Spanish isolates of BcMV1.