Cloned origin of DNA replication in c-myc gene can function and be transmitted in transgenic mice in an episomal state.

The c-myc protein has recently been shown to interact with a region possessing putative origin of DNA replication and enhancer activities located 2 kb upstream of the c-myc gene itself. Transgenic mice were obtained by injecting constructs containing this region, termed pmyc(H-P), into fertilized mouse eggs. The transgenic elements were capable of efficient replication in all mouse tissues examined and were maintained in an episomal state even in highly differentiated cells. Moreover, pmyc(H-P) was transmittable to the progeny throughout several generations, which suggests that the fragment derived from the region upstream of the c-myc gene possesses sequences necessary for partition, stability and DNA replication of the plasmid in the cells. In addition, we have shown that the plasmid might be captured only by eggs, not by sperm.     

Two enhancer elements for DNA replication of pSC101, par and a palindromic binding sequence of the Rep protein.

The minimal replication origin (ori) of the plasmid pSC101 has been previously defined as an approximately 220-bp region by using plasmids defective in the par region, which is a cis-acting determinant of plasmid stability. This ori region contains the DnaA binding sequence, three repeated sequences (iterons), and an inverted repeat (IR) element (IR-1), one of the binding sites of an initiator protein, Rep (or RepA). In the present study, we show that plasmids containing par can replicate at a nearly normal copy number in the absence of IR-1 but still require a region (the downstream region) between the third iteron and IR-1. Because par is dispensable in plasmids retaining IR-1, par and IR-1 can compensate each other for efficient replication. The region from the DnaA box to the downstream region can support DNA replication at a reduced frequency, and it is designated "core-ori." Addition of either IR-1 or par to core-ori increases the copy number of the plasmid up to a nearly normal level. However, the IR-1 element must be located downstream of the third iteron (or upstream of the rep gene) to enhance replication of the plasmid, while the par region, to which DNA gyrase can bind, functions optimally regardless of its location. Furthermore, the enhancer activity of IR-1 is dependent on the helical phase of the DNA double helix, suggesting that the Rep protein bound to IR-1 stimulates the activation of ori via its interaction with another factor or factors capable of binding to individual loci within ori.     

Replication enhancer-independent mutation increases the co-operativity with which an initiator protein binds its origin

The plus-strand replication origin of bacteriophage fl has a bipartite structure consisting of a required core origin region and an adjacent A + T-rich enhancer sequence that potentiates replication approximately 100-fold. The core origin binds the initiator protein (gpII) and the enhancer binds the Escherichia coli integration host factor (IHF). gpII binds the core origin in two steps, forming a binding intermediate (complex I) and a functional complex for nicking (complex II). We have used a double-label gel binding assay to determine the stoichiometry of the gpII-origin interaction. The results indicate that complex I contains two gpII molecules per origin, and complex II contains four gpII molecules per origin. Enhancer-independent mutations in gpII allow wild-type levels of replication in the absence of either the enhancer or IHF. We have examined the binding of an enhancer-independent gpII mutant (mp1) protein to the replication origin. The mp1 mutation in gpII (Met40----Ile) increases the co-operativity with which the protein binds to form complex II. In addition, the mutant gpII forms both complexes with a DNA fragment containing only two (beta-gamma) of the three repeats from the core origin sequence, while the wild-type protein forms only complex I with this fragment. We discuss how a mutation that increases the co-operativity of binding of an initiator protein might stimulate DNA replication.     

Activity of the c-myc Replicator at an Ectopic Chromosomal Location

DNA replication starts at multiple discrete sites across the human chromosomal c-myc region, including two or more sites within 2.4 kb upstream of the c-myc gene. The corresponding 2.4-kb c-myc origin fragment confers autonomously replicating sequence (ARS) activity on plasmids, which specifically initiate replication in the origin fragment in vitro and in vivo. To test whether the region that displays plasmid replicator activity also acts as a chromosomal replicator, HeLa cell sublines that each contain a single copy of the Saccharomyces cerevisiae FLP recombinase target (FRT) sequence flanked by selectable markers were constructed. A clonal line containing a single unrearranged copy of the transduced c-myc origin was produced by cotransfecting a donor plasmid containing the 2.4-kb c-myc origin fragment and FRT, along with a plasmid expressing the yeast FLP recombinase, into cells containing a chromosomal FRT acceptor site. The amount of short nascent DNA strands at the chromosomal acceptor site was quantitated before and after targeted integration of the origin fragment. Competitive PCR quantitation showed that the c-myc origin construct substantially increased the amount of nascent DNA relative to that at the unoccupied acceptor site and to that after the insertion of non-myc DNA. The abundance of nascent strands was greatest close to the c-myc insert of the integrated donor plasmid, and significant increases in nascent strand abundance were observed at sites flanking the insertion. These results provide biochemical and genetic evidence for the existence of chromosomal replicators in metazoan cells and are consistent with the presence of chromosomal replicator activity in the 2.4-kb region of c-myc origin DNA.     

Major DNA replication initiation sites in the c-myc locus in human cells

DNA replication initiation sites and initiation frequencies over 12. 5 kb of the human c-myc locus, including 4.6 kb of new 5' sequence, were determined based on short nascent DNA abundance measured by competitive polymerase chain reaction using 21 primer sets. In previous measurements, no comparative quantitation of nascent strand abundance was performed, and distinction of major from minor initiation sites was not feasible. Two major initiation sites were identified in this study. One predominant site has been located at approximately 0.5 kb upstream of exon 1 of the c-myc gene, and a second new major site is located in exon 2. The site in exon 2 has not been previously identified. In addition, there are other sites that may act as less frequently used initiation sites, some of which may correspond to sites in previous reports. Furthermore, a comparison of the abundance of DNA replication intermediates over this same region of the c-myc locus between HeLa and normal skin fibroblast (NSF) cells indicated that the relative distribution was very similar, but that nascent strand abundance in HeLa cells was approximately twice that in NSF relative to the abundance at the lamin B2 origin. This increased activity at initiation sites in the c-myc locus may mainly be influenced by regulators at higher levels in transformed cells like HeLa.     

Interference between M13 and oriM13 plasmids is mediated by a replication enhancer sequence near the viral strand origin

The origin of replication for the viral strand of bacteriophage M13 DNA is contained within a 507 base-pair intergenic region of the phage chromosome. The viral strand origin is defined as the specific site at which the M13 gene II protein nicks the duplex replicative form of M13 DNA to initiate rolling-circle synthesis of progeny viral DNA. Using in vitro techniques we have constructed deletion mutations in M13 DNA at the unique AvaI site which is located 45 nucleotides away on the 3' side of the gene II protein nicking site. This deletion analysis has identified a sequence near the viral strand origin that is required for efficient replication of the M13 genome. We refer to this part of the intergenic region as a "replication enhancer" sequence. We have also studied the function of this sequence in chimeric pBR322-M13 plasmids and found that plasmids carrying both the viral strand origin and the replication enhancer sequence interfere with M13 phage replication. Based upon these findings we propose a model for the mechanism of action of the replication enhancer sequence involving binding of the M13 gene II protein.     

The TGGCA protein binds to the MMTV-LTR, the adenovirus origin of replication, and the BK virus enhancer.

TGGCA-binding proteins are nuclear proteins with high affinity for double-stranded DNA homologous to the prototype recognition sequence 5'YTGGCANNNTGCCAR 3'. Their ubiquitous tissue distribution in higher vertebrates characterizes them as a class of highly conserved proteins which may exert a basic function. To obtain clues to this function, specific binding sites were mapped on three viral genomes. Recognition sites were identified in the enhancer region of the BK virus, in the LTR of the mouse mammary tumor virus, and in the origin of replication of adenovirus 12. The TGGCA-binding protein from HeLa cells appears to be identical to nuclear factor I described by others, which stimulates initiation of adenovirus DNA replication in vitro. However, data from MMTV, BKV, and from cellular genes suggest that this specific protein-DNA interaction may also be involved in the control of gene activity.     

Binding of a novel host factor to the pT181 plasmid replication enhancer.

Replication enhancers are cis-acting genetic elements that stimulate the activity of origins of DNA replication. The enhancer found in plasmid pT181 of Staphylococcus aureus, called cmp, functions at a distance of 1 kb from the origin of DNA replication to stimulate the interaction between the replication initiation protein and the origin. DNA encoding cmp-binding activity was isolated by screening an expression library of S. aureus DNA in Escherichia coli, and a novel gene, designated cbf1, was identified. The cbf1 locus codes for a polypeptide of 313 amino acid residues (cmp-binding factor 1 [CBF1]; Mr = 35,778). In its COOH-terminal region, the protein sequence contains the helix-turn-helix motif common to many DNA binding proteins that usually bend DNA. The specificity of CBF1 binding for cmp was demonstrated by affinity chromatography using cmp DNA and by competition binding studies. DNase I footprinting analysis of the CBF1-cmp complexes revealed DNase I-hypersensitive sites in phase with the helical periodicity of DNA, implying that CBF1 increases distortion of the intrinsically bent cmp DNA.     

The nucleotide sequence for the replication region of pVS40, a lactococcal food grade cloning vector

The replication region of a limited host range lactococcal vector, pVS40, was located within a 2359 bp Eco RI- Cla I fragment. Within this fragment a sequence for a 1197 bp reading frame coding for a 46 826 Da protein together with a putative ribosomal binding site and the -10 and -35 promoter regions could be detected. Immediately upstream from the promoter were three complete and one nearly complete successive direct repeats (TATAGCGTATGAAAAAACTGTG), suggesting an origin of replication. The protein has considerable homologies to certain lactococcal plasmid replication proteins.