Effect of Biocides on MS2 and K Coliphages

Several biocides commonly used in disinfection processes as antibacterial and antifungal agents were tested for activity against MS2 and K coliphages. MS2 was resistant to most biocides; only glutaraldehyde (0.5%) and peracetic acid (1%) achieved a 4-log₁₀ titer reduction in 20 min. In contrast, K phage was sensitive to most biocides, being resistant only to phenol (2%) and chlorhexidine (1%).     

Calicivirus Inactivation by Nonionizing (253.7-Nanometer-Wavelength [UV]) and Ionizing (Gamma) Radiation

Noroviruses (previously Norwalk-like viruses) are the most common viral agents associated with food- and waterborne outbreaks of gastroenteritis. In the absence of culture methods for noroviruses, animal caliciviruses were used as model viruses to study inactivation by nonionizing (253.7-nm-wavelength [UV]) and ionizing (gamma) radiation. Here, we studied the respiratory feline calicivirus (FeCV) and the presumed enteric canine calicivirus (CaCV) and compared them with the well-studied bacteriophage MS2. When UV irradiation was used, a 3-log₁₀ reduction was observed at a fluence of 120 J/m² in the FeCV suspension and at a fluence of 200 J/m² for CaCV; for the more resistant phage MS2 there was a 3-log₁₀ reduction at a fluence of 650 J/m². Few or no differences were observed between levels of UV inactivation in high- and low-protein-content virus stocks. In contrast, ionizing radiation could readily inactivate MS2 in water, and there was a 3-log₁₀ reduction at a dose of 100 Gy, although this did not occur when the phage was diluted in high-protein-content stocks of CaCV or FeCV. The low-protein-content stocks showed 3-log₁₀ reductions at a dose of 500 Gy for FeCV and at a dose of 300 for CaCV. The inactivation rates for both caliciviruses with ionizing and nonionizing radiation were comparable but different from the inactivation rates for MS2. Although most FeCV and CaCV characteristics, such as overall particle and genome size and structure, are similar, the capsid sequences differ significantly, making it difficult to predict human norovirus inactivation. Adequate management of UV and gamma radiation processes for virus inactivation should limit public health risks.     

Messenger Discriminating Species of Initiation Factor F<Subscript>3</Subscript>

Species of the polypeptide chain initiation factor F₃ with high selectivity toward either MS2 or T4 phage messenger RNAs have been isolated from normal E. coli cells.     

Escherichia coli traD(Ts) mutant temperature sensitive for assembly of RNA bacteriophage MS2.

We report here a study on the temperature-sensitive conjugational transfer-deficient mutant Escherichia coli JCFL39, carrying a traD(Ts) mutation, which is also temperature sensitive for group I RNA phages (MS2, f2, and R17). It is shown that, when the mutant was infected with MS2 at 42 degrees C, phage RNA replicated; a 27S MS2 RNA and phage proteins were synthesized. However, neither PFU nor physical MS2 particles were formed, showing that phage assembly was inhibited. In addition, the high temperature affected the membranes of the host mutant: the mutant was hypersensitive to chemicals, and the electrophoretic pattern of the membranal proteins was modified. We suggest that the pleiotropic effects of the traD mutation on MS2 assembly and DNA transfer during conjugation were a result of the changes in the membrane of the mutant.     

Interaction of RNA-containing bacteriophages with the host cells: MS2-induced E. coli mutants and formation of DNA-containing derivatives of MS2 bacteriophage

Sensitive cells of Escherichia coli AB 259 Hfr 3000 infected with RNA-containing phage MS2 produce phage particles and continue to divide showing segregation of sensitive cells maintaining new infection cycles. Phage multiplication in sensitive cells gives rise to phage resistant forms in their progeny. The described phenomenon has been shown to be due not to pre-existing phage-resistant cell selection but is a result of interaction of the phage and the cell. In contrast to the usual spontaneous or chemically induced Escherichia coli mutants MS2-induced phage-resistant cells are genetically unstable. During their reproduction they segregate new MS2-resistant types carrying more significant changes in the region coded by the sex factor. Cells belonging to two final MS2-induced mutants also produce a new type of phages; they are DNA-containing forms neutralized, however, by anti-MS2 serum. Production of such phage proves that genetic moiety of RNA-containing phage is able to be expressed as a part of the DNA structure.     

Inhibition of Formation of Escherichia coli Mating Pairs by f1 and MS2 Bacteriophages as Determined with a Coulter Counter

The effect of male-specific filamentous deoxyribonucleic acid (f1) and isometric ribonucleic acid (MS2) bacteriophages on the formation of mating pairs in Escherichia coli conjugation was examined directly in the Coulter counter. When a sufficient multiplicity of infection (MOI) was used, the f1 phage immediately and completely inhibited the formation of mating pairs. On the other hand, the MS2 phage at a relatively high MOI also inhibited the formation of mating pairs significantly although not completey. The inhibitory effect of MS2 phage was dependent on the time of addition and the MOI used. At relatively low MOI (<20), the MS2 phage showed some inhibitory effect when added to a male culture prior to mixing with females, whereas no effect was observed when phages were added after mating pair formation had already commenced. At a high MOI (>400) MS2 phage disrupted the mating pairs already formed. Some preformed mating pairs were resistant to the high MOI of MS2 phages, however, and the "sensitive" (to high MOI) mating pairs seem to mature into "resistant" mating pairs as a function of time. We conclude that the tip of an F pilus is the specific attachment site for mating. The following process of mating pair formation has been formulated by deduction. (i) The sides of F pili weakly contact female cells, (ii) then the tips of F pili attach to the specific receptor sites to form initial mating pairs, and (iii) those pairs mature into mating pairs that are resistant to the high MOI of MS2 phages. The high MOI of MS2 prevents the first step, whereas f1 phages affect the second step-the binding between the tips of F pili and the receptor sites.     

Characterization of an intergroup serological mutant from group II RNA phage GA

Starting from the group II RNA phage GA which has an amber mutation in the maturation protein cistron, a spontaneous mutant of group II phage GA, whose serological and electrophoretic properties became similar to those of group I phage MS2, was isolated and analyzed. The mutant has now become sensitive to anti-MS2 serum and resistant to anti-GA serum. Analysis of the nucleotide sequence of the coat protein gene revealed that G----A transition was the main change. The deduced amino acid sequence showed that five amino acids were substituted in the mutant, and three of the five became identical to MS2, resulting in increased molecular weight of the coat protein. However, it did not complement MS2. These results suggested that the serological change from group II phage GA type to group I phage MS2 type is induced spontaneously at high frequency by minor nucleotide changes in coat protein gene, and confirmed the previous results at the RNA level that MS2 and GA were related although the closeness between them seems somewhat remoter than that of groups III and IV (18, Inokuchi et al, unpublished data for the nucleotide sequence of group IV phage SP).     

Photocatalytic inactivation rate of phage MS2 in titanium dioxide suspensions containing various ionic species

In the TiO₂ photoreaction system, the coexistence of NO₃ ^–, SO₄ ^2–, PO₄ ^3–, K⁺ or Ca²⁺ each at 10–100 mM decreased the rate constant for phage MS2 inactivation, but Cl^–, Br^– or Na⁺ did not. The inhibitory effects of the ions could be elucidated by the proportional relation found between the rate constants and quantities of the phage on TiO₂ irrespective of the kinds of existing ions.     

Nondiscrimination of RNA viral message in binding to 30S ribosomes derived from T4 phage infected Escherichia coli

The effect of T4 phage on ribosomes in terms of their ability to bind RNA viral template is examined. It is found that the 30S subunits of T4 ribosomes bind MS2 RNA as efficiently as do the subunits of uninfected $\text{E. coli}$ ribosomes. On the other hand, analyses of the formation of 70S initiation complex, presumably from MS2 RNA-30S ribosome complex, using both labeled MS2 RNA and initiator tRNA, reveal that T4 ribosomes are only about half as active as $\text{E. coli}$ ribosomes. The latter phenomenon has been reported previously. These results suggest that, following T4 infection, ribosomes are modified in such a way that the attachment of fMet-tRNA_f to MS2 RNA-30S subunit complex is impaired.     

Low-Frequency Electromagnetic Fields Alter the Replication Cycle of MS2 Bacteriophage

The effect of exposure to 60-Hz electromagnetic fields (EMFs) on RNA coliphage MS2 replication was studied. EMF exposure commenced when the bacterial cultures were inoculated with the phage (t = 0). In 12 experiments in which the strength of the field was 5 G, a significant delay in phage yield was found in the EMF-exposed cultures 45–65 min after inoculation, compared with control cultures. However, the EMF did not alter the final phage concentration. Experiments at 25 G (N = 5) suggested that the stronger field resulted in both impeded phage replication and increased phage yield. No differences between test groups were found in experiments involving sham-EMF exposure, thereby indicating that the results obtained with the EMFs were not due to systematic error. It appears that MS2, which codes for only four proteins, is the simplest biological system in which an EMF-induced effect has been demonstrated. The MS2 system is, therefore, conducive to follow-up studies aimed at understanding the level and nature of the underlying interaction process, and perhaps to biophysical modeling of the interaction process. Received: 26 August 1997 / Accepted: 17 November 1997     

Interaction of RNA-containing bacteriophages with host cell: MS2-induced mutants of <Emphasis Type="Italic">E. coli</Emphasis> and the occurrence of DNA-containing derivatives of the bacteriophage MS2

Sensitive cells of Escherichia coli AB 259 Hfr 3000 infected with RNA-containing phage MS2 produce phage particles and simultaneously continue to divide, thereby segregating sensitive cells capable of sustaining new cycles of infection. Multiplication of phage in sensitive cells gives rise to phage-resistant forms in the progeny of these cells. It is shown that this phenomenon is due not to selection of pre-existing phage-resistant mutants, but is instead the result of interaction between the phage and the cell. Unlike ordinary spontaneous or chemically induced E. coli mutants, MS2-induced phage-resistant cells are genetically unstable forms. In the course of reproduction they segregate new MS2-resistant forms with more highly expressed variations in the region encoded by the sex factors. Cells of the two final forms of MS2-induced mutants also produce a new type of phage. This new type constitutes DNA-containing forms which, however, are neutralized by anti-MS2-serum. The segregation of these forms serves to confirm that the genetic substance of the RNA-containing bacteriophage is capable of being expressed as a component of the DNA-containing structure.     

Gene N regulator function of phage λimm21: Evidence that a site of N action differs from a site of N recognition

We report the isolation and characterization of a new mutation in the hybrid phage λimm21. Both genetic and physiological studies demonstrate that this new mutation, N_21?1, is similar to N mutations of phage λ. As in the case of the N gene of λ (Ni_λ), the N_21?1 mutation maps immediately to the left of the cI gene and has a pleiotropic effect on the expression of phage functions. Although these studies strongly suggest that phage 21 has an N function, they do not definitely locate the N_21?1 mutation within the N₂₁ structural gene.Reported here are studies demonstrating that N₂₁ acts in trans, similar to N_λ, to stimulate the expression of phage functions. N products show an immunity specificity; N₂₁ being only active on phage carrying the immunity region of phage 21, while the n_λ is only active on phage carrying the immunity region of λ or phage 434. However, one site of action for N_λ can be rescued from phage 21. We propose that the specificity of an N function is determined by its sites of recognition and that these sites may be different from the sites of N action.     

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.     

Proteomic analysis and protein structure prediction of Shigella phage Sfk20 based on a comparative study using structure prediction approaches

Bacteriophages are the natural predators of bacteria and are available abundantly everywhere in nature. Lytic phages can specifically infect their bacterial host (through attachment to the receptor) and use their host replication machinery to replicate rapidly, a feature that enables them to kill a disease-causing bacteria. Hence, phage attachment to the host bacteria is the first important step of the infection process. It is reported in this study that the receptor could be an LPS which is responsible for the attachment of the Sfk20 phage to its host (Shigella flexneri 2a). Phage Sfk20 bacteriolytic activity was examined for preliminary optimization of phage titer. The phage Sfk20 viability at different saline conditions was conducted. The LC–MS/MS technique used here for detecting and identifying 40 Sfk20 phage proteins helped us to get an initial understanding of the structural landscape of phage Sfk20. From the identified proteins, six structurally significant proteins were selected for structure prediction using two neural network systems: AlphaFold2 and ESMFold, and one homology modeling software: Phyre2. Later the performance of these modeling systems was compared using various metrics. We conclude from the available and generated information that AlphaFold2 and Phyre2 perform better than ESMFold for predicting Sfk20 phage protein structures.     

The regulatory region of MS2 phage RNA replicase cistron. Functional activity of individual MS2 RNA fragments

The present work deals with the structural-functional organization of regulatory regions of messenger RNAs. Some principles of the action of a translational repressor (coat protein) and the formation of the ribosomal initiation complex at the replicase cistron have been studied with MS2 phage RNA. When the complex of MS2 RNA with the coat protein is treated with T₁ ribonuclease, the coat protein selectively protects mainly two fragments (59 and 103 nucleotides in length) from digestion; these fragments contain the intercistronic regulatory region and the beginning of the MS2 replicase cistron. These polynucleotides have been isolated in a pure state and their primary structure has been established.It has been established that both MS2 RNA fragments contain all the necessary information for specific interaction with MS2 coat protein and form a complex with it with an efficiency close to that observed in the case of native MS2 RNA. They also provide the normal polypeptide chain initiation at the replicase cistron. Enzymatic binding of the second aminoacyl-tRNA and electrophoretic analysis of N-terminal dipeptides prove that only the true initiator codon of the replicase cistron is recognized by a ribosome despite the presence of a few additional AUG triplets within the polynucleotides. Under conditions of limited hydrolysis by T₁ ribonuclease, the beginning of the replicase cistron has been removed from the shortest polynucleotide leading to a complete loss of its ability to bind both the coat protein and a ribosome.Some principles of the functioning of the regulatory region in MS2 RNA as well as the nature of the initiator signal of protein biosynthesis are discussed.     

Studies on Sex Pili: Mutants of the Sex Factor F in Escherichia coli Defective in Bacteriophage-Adsorbing Function of F Pili

Ultraviolet irradiation or nitrosoguanidine treatment of Escherichia coli K-12 strain JE3100 (F'(8)/fla pil) led to the isolation of six mutants defective in F pili function. The defects were shown to be caused by mutations in the F factor. The mutants retained conjugal fertility, although they were less efficient than parental F'(8) strain, and continued to synthesize F pili. Three of the mutants (strains KE196, 198, and 200) had lost sensitivity to male-specific MS2 phage, and the other three (strains KE161, 163, and 164) were insensitive to Qbeta and f1 as well as MS2 phages. F pili on strains KE196, 198, and 200 cells continued to adsorb MS2 phage, whereas those of strains KE161, 163, and 164 did not adsorb MS2 phage. The correlation of the mutant phenotypes with those of other F mutants reported in the literature is discussed.     

Inhibition of β-galactosidase synthesis inEscherichia coli after infection with different DNA and RNA phages

Infection ofEscherichia coli with T1, T2r⁺, T3 and T4 phages leads to an immediate inhibition of β-galactosidase synthesis. Similar results were obtained with the virulent mutant of phage lambda. The degree of inhibition of β-galactosidase synthesis depends on the time delay between the addition of the inducer and the phage particles, and on the amount of phage DNA, which has penetrated into the host cell. RNA phage MS2 exhibited no inhibitory effect on enzyme synthesis.     

Functioning of the cloned phage MS2 lysis protein in Escherichia coli impaired in murein synthesis

Abstract The mode of action of the phage MS2 lysis protein seems not to involve a direct interaction with the murein synthesis machinery as is the case for lysis induced by β-lactam antibiotics. Mutants with defects in various penicillin-binding proteins, which are involved in murein synthesis, were found to show normal lysis sensitivity towards the cloned MS2 lysis protein. In addition, both processes, longitudinal growth of the murein sacculus in the presence of furazlocillin, cephalexin and nalidixic acid as well as spherical growth in the presence of mecillinam were sensitive to the phage lysis protein. No change in the capacity of the binding proteins to bind ¹⁴C-labelled penicillin G was observed in the presence of the MS2 lysis gene product.     

Effects of GUG and AUG initiation codons on the expression of lacZ in Escherichia coli

We have replaced the ribosomal binding site (RBS) of the lacZ gene of E. coli by those of the maturation (A) gene of phage MS2 and that of the tufA gene. Both RBSs contain a GUG initiation codon. The expression with the tufA RBS is at least 25-fold higher than with the phage RBS. Changing the GUG into AUG results in a 3-fold increase in expression in both cases. In general, higher expression is accompanied by an increase of lac-specific mRNA. It is argued that this is a consequence of the more efficient translation of the mRNA.