共查询到20条相似文献,搜索用时 15 毫秒
1.
Mateusz Wilamowski Michal Hammel Wellington Leite Qiu Zhang Youngchang Kim Kevin L. Weiss Robert Jedrzejczak Daniel J. Rosenberg Yichong Fan Jacek Wower Jan C. Bierma Altaf H. Sarker Susan E. Tsutakawa Sai Venkatesh Pingali Hugh M. ONeill Andrzej Joachimiak Greg L. Hura 《Biophysical journal》2021,120(15):3152-3165
2.
Pantelis Georgiades Paul D. A. Pudney David J. Thornton Thomas A. Waigh 《Biopolymers》2014,101(4):366-377
The rheological characteristics of gastric and duodenal mucin solutions, the building blocks of the mucus layer that covers the epithelia of the two organs, were investigated using particle tracking microrheology. We used biochemically well characterized purified porcine mucins (MUC5AC and MUC2) as models for human mucins, to probe their viscoelasticity as a function of mucin concentration and pH. Furthermore, we used both reducing (dithiothreitol, DTT) and chaotropic agents (guanidinium chloride and urea) to probe the mesoscopic forces that mediate the integrity of the polymer network. At neutral pH both gastric and duodenal mucins formed self‐assembled semi‐dilute networks above a certain critical mucin concentration (c*) with the viscosity (η) scaling as for MUC5AC and for MUC2, where c is the mucin concentration. Above an even higher mucin concentration threshold (ce, the entanglement concentration) reptation occurs and there is a dramatic increase in the viscosity scaling, for MUC5AC and for MUC2. The dynamics of the self‐assembled comb polymers is examined in terms of a scaling model for flexible polyelectrolyte combs. Both duodenum and gastric mucin are found to be pH switchable gels, gelation occurring at low pHs. There is a hundred‐fold increase in the elastic shear modulus once the pH is decreased. The addition of DTT, guanidinium chloride and urea disassembles both the semi‐dilute and gel structures causing a large increase in the compliance (decrease in their shear moduli). Addition of the polyphenol EGCG has a reverse effect on mucin viscoelasticity, that is, it triggers a sol–gel transition in semi‐dilute mucin solutions at neutral pH. © 2013 The Authors. Biopolymers published by Wiley Periodicals, Inc. Biopolymers 101: 366–377, 2014. 相似文献
3.
Kazuhiko Ishihara Makoto Kurihara Yukinobu Goso Hiroyoshi Ota Tsutomu Katsuyama Kyoko Hotta 《Glycoconjugate journal》1996,13(5):857-864
Eight monoclonal antibodies (MAbs), designated RGM21 RGM42, were generated against mucin purified from the rat gastric mucosa. By applying ELISA, all of these MAbs were proved to react not only with the purified mucin, but also with the oligosaccharide mixture obtained from the antigenic mucin by alkaline borohydride treatment. Treatment of the mucin-attached ELISA well with trypsin, sodium periodate or galactose oxidase prior to the addition of the MAb was applied to characterize these MAbs. Histochemical observation indicated that all these MAbs were able to stain the formalin fixed-paraffin embedded sections of the rat gastroduodenal mucosa. Although each of these MAbs reacted with distinct mucus-producing cells localized in particular regions of the gastroduodenal mucosa, their staining specificity could generally be classified into four groups. These MAbs might be useful for estimating the physiological and pathological changes of mucins in the gastric mucosa. 相似文献
4.
Joana Gomes Nuno T. Marcos Nora Berois Eduardo Osinaga Ana Magalh?es Jo?o Pinto-de-Sousa Raquel Almeida Fátima G?rtner Celso A. Reis 《The journal of histochemistry and cytochemistry》2009,57(1):79-86
Aberrant mucin O-glycosylation is often observed in cancer and is characterized by the expression of immature simple mucin-type carbohydrate antigens. UDP-N-acetyl-d-galactosamine:polypeptide N-acetylgalactosaminyltransferase-6 (ppGalNAc-T6) is one of the enzymes responsible for the initial step in O-glycosylation. This study evaluated the expression of ppGalNAc-T6 in human gastric mucosa, intestinal metaplasia, and gastric carcinomas. Our results showed that ppGalNAc-T6 is expressed in normal gastric mucosa and in intestinal metaplasia. A heterogeneous expression and staining pattern for this enzyme was observed in gastric carcinomas. ppGalNAc-T6 was expressed in 79% of the cases, and its expression level was associated with the presence of venous invasion. Our results provide evidence that ppGalNAc-T6 is an IHC marker associated with venous invasion in gastric carcinoma and may contribute to the understanding of the molecular mechanisms that underlie aberrant glycosylation in gastric carcinogenesis and in gastric carcinoma. 相似文献
5.
Wright NT Raththagala M Hemmis CW Edwards S Curtis JE Krueger S Schildbach JF 《Proteins》2012,80(9):2250-2261
TraI, the F plasmid-encoded nickase, is a 1756 amino acid protein essential for conjugative transfer of plasmid DNA from one bacterium to another. Although crystal structures of N- and C-terminal domains of F TraI have been determined, central domains of the protein are structurally unexplored. The central region (between residues 306 and 1520) is known to both bind single-stranded DNA (ssDNA) and unwind DNA through a highly processive helicase activity. Here, we show that the ssDNA binding site is located between residues 381 and 858, and we also present the high-resolution solution structure of the N-terminus of this region (residues 381-569). This fragment folds into a four-strand parallel β sheet surrounded by α helices, and it resembles the structure of the N-terminus of helicases such as RecD and RecQ despite little sequence similarity. The structure supports the model that F TraI resulted from duplication of a RecD-like domain and subsequent specialization of domains into the more N-terminal ssDNA binding domain and the more C-terminal domain containing helicase motifs. In addition, we provide evidence that the nickase and ssDNA binding domains of TraI are held close together by an 80-residue linker sequence that connects the two domains. These results suggest a possible physical explanation for the apparent negative cooperativity between the nickase and ssDNA binding domain. 相似文献
6.
Rajkumar Ramachandran Devaraj Halagowder Niranjali Sivasithamparam 《Molecular and cellular biochemistry》1998,178(1-2):261-268
Invasion of epithelial cells by Shigella is an early step in their pathogenesis. Adherence is generally presumed to be a prerequisite for invasion. This study examined the possibility of intestinal mucins serving as initial binding sites for clinical isolates of S. boydii and S. sonnei. The interactions of Shigella with rat and human small intestinal and colonic mucin were investigated. In solid phase binding assays, [35S] labelled Shigella did not show any preferential binding to rat/human small intestinal mucin or to rat colonic mucin. On the other hand, Shigella bound specifically to human colonic mucin in a concentration-dependent manner. This specific binding to human colonic mucin was not by weak hydrophobic interactions and could not be attributed to the presence of contaminating glycolipids in the mucin preparation. The human colonic mucin receptor was sensitive to periodate treatment suggesting the involvement of the carbohydrate portion of the mucin. Reduction and alkylation of mucin enhanced adherence probably by exposing buried binding sites. The monosaccharides present in mucins were ineffective as hapten inhibitors as was the lectin wheat germ agglutinin suggesting that the mucin receptor is a more complex one. This study identifies, for the first time, the presence of a specific Shigella-binding site on the carbohydrate portion of human colonic mucin, which is not present in rat colonic mucin or in rat/human small intestinal mucin. 相似文献
7.
Sren A. R. Kynde Nicholas Skar‐Gislinge Martin Cramer Pedersen Sren Roi Midtgaard Jens Baek Simonsen Ralf Schweins Kell Mortensen Lise Arleth 《Acta Crystallographica. Section D, Structural Biology》2014,70(2):371-383
Monomeric bacteriorhodopsin (bR) reconstituted into POPC/POPG‐containing nanodiscs was investigated by combined small‐angle neutron and X‐ray scattering. A novel hybrid approach to small‐angle scattering data analysis was developed. In combination, these provided direct structural insight into membrane‐protein localization in the nanodisc and into the protein–lipid interactions. It was found that bR is laterally decentred in the plane of the disc and is slightly tilted in the phospholipid bilayer. The thickness of the bilayer is reduced in response to the incorporation of bR. The observed tilt of bR is in good accordance with previously performed theoretical predictions and computer simulations based on the bR crystal structure. The result is a significant and essential step on the way to developing a general small‐angle scattering‐based method for determining the low‐resolution structures of membrane proteins in physiologically relevant environments. 相似文献
8.
Hayama M Kawakami Y Kaneko Y Sano K Ota H 《Journal of cellular and molecular medicine》2005,9(3):746-747
We investigated the effect of H. pylori infection on cell proliferation of gastric mucosa using immunostaining for H. pylori or Ki67. H. pylori cells attached to surface mucous cells covering luminal surface and the upper part of gastric foveolae, and up-regulated the proliferative activity of gastric epithelial cells without adhering to the proliferating epithelial cells. 相似文献
9.
Helicobacter pylori infection up-regulates gland mucous cell-type mucins in gastric pyloric mucosa 总被引:1,自引:0,他引:1
Matsuzwa M Ota H Hayama M Zhang MX Sano K Honda T Ueno I Akamatsu T Nakayama J 《Helicobacter》2003,8(6):594-600
Background. Two types of mucous cell are present in gastric mucosa: surface mucous cells (SMCs) and gland mucous cells (GMCs), which consist of cardiac gland cells, mucous neck cells, and pyloric gland cells. We have previously reported that the patterns of glycosylation of SMC mucins are reversibly altered by Helicobacter pylori infection. In this study, we evaluated the effects of H. pylori infection on the expression of GMC mucins in pyloric gland cells. Methods. Gastric biopsy specimens from the antrums of 30 H. pylori‐infected patients before and after eradication of H. pylori and 10 normal uninfected volunteers were examined by immunostaining for MUC6 (a core protein of GMC mucins), α1,4‐N‐acetyl‐glucosaminyl transferase (α4GnT) (the glycosyltransferase which forms GlcNAcα1‐4Galβ‐R), and GlcNAcα1‐4Galβ‐R (a GMC mucin‐specific glycan). Results. MUC6, α4GnT, and HIK1083‐reactive glycan were expressed in the cytoplasm, supranuclear region, and secretory granules in pyloric gland cells, respectively. The immunoreactivity of MUC6 and α4GnT, but not of GlcNAcα1‐4Galβ‐R, in the pyloric gland increased in H. pylori‐associated gastritis, and after the eradication of H. pylori, the increased expression of MUC6 and α4GnT in the gastric mucosa of H. pylori‐infected patients decreased to almost normal levels. This up‐regulation was correlated with the degree of inflammation. Conclusions. In addition to the synthesis of GMC mucins increasing reversibly, their metabolism or release may also increase reversibly in H. pylori‐associated gastritis. The up‐regulation of the expression of gastric GMC mucins may be involved in defense against H. pylori infection in the gastric surface mucous gel layer and on the gastric mucosa. 相似文献
10.
Corynebacterium equi IFO 3730 was found to oxidize a wide variety of sec-alcohols, including alkanols, substituted alkanols, alkenols and cyclic alcohols, in moderate to high yields. Among them, the sec-alcohols which have longer carbon chains were oxidized more smoothly than those with smaller numbers of carbon. Although both enantiomers of unsymmetrically disubstituted carbinols were oxidized, the S form of 2-dodecanol was converted to the corresponding ketone a little faster than the other enantiomer. 相似文献
11.
Yamamoto K Kato M Takahashi M Haneda M Shinada K Nishida U Yoshida T Sonoda N Ono S Nakagawa M Mori Y Nakagawa S Mabe K Shimizu Y Moriya J Kubota K Matsuno Y Shimoda T Watanabe H Asaka M 《Helicobacter》2011,16(3):210-216
Background and Aims: The results of a randomized controlled study and meta‐analysis study have recently proved that Helicobacter pylori eradication has a preventive effect against the development of metachronous and primary gastric cancer. However, gastric cancer is sometimes detected after successful eradication. There is a lack of study about gastric cancers in eradicated patients. To clarify the characteristics of gastric cancers detected after H. pylori eradication, we analyzed the clinicopathological features of these cancers. Methods: The subjects were 18 early‐stage gastric cancer specimens resected from 17 patients who had received successful eradication of H. pylori from February 1995 to March 2009. The control group consisted of 36 specimens from noneradicated patients with persistent H. pylori infection who were matched with the subjects in age, sex, and depth of invasion. Clinicopathological features and mucin phenotypes of gastric cancer were clinically and immunohistologically evaluated. Results: The average diameter of gastric cancer was smaller and Ki‐67 index was lower in the eradication group. The morphological distribution of depression types was significantly lower in the control group. Immunohistochemical phenotyping revealed that 72.2% of the lesions in the eradicated group were complete gastric type or gastric predominant mixed type, whereas the percentages of gastric type and intestinal type in the control group were similar. Conclusion: Our findings indicate that the clinicopathological characteristics of gastric cancers detected after H. pylori eradication are different from those of gastric cancers in patients with persistent H. pylori infection. H. pylori eradication may suppress intestinalization during the development of gastric cancer. 相似文献
12.
Hedemann MS Clausen TN Jensen SK 《Animal : an international journal of animal bioscience》2011,5(3):394-402
Weaning of livestock mammals is often associated with digestive problems related to profound changes in the physiology of the gastrointestinal tract. This study was undertaken to study the developmental changes in the gastrointestinal tract of mink kits during the period of 34 to 59 days of age. Twenty-four mink kits from eight litters were included in the experiment. The dams and their litters were kept under standard farm conditions. The dams and the kits were fed a diet consisting of 48.1% protein, 40.7% fat and 11.1% carbohydrate of metabolizable energy. The mink kits were weaned at 42 days of age. At 34, 47 and 59 days of age, one male mink kit from each litter was euthanized. The activity of amylase, trypsin, chymotrypsin and lipase in the pancreatic tissue increased during the experimental period, whereas the activity of carboxyl ester hydrolase remained constant. The vitamin E concentration in plasma was stable from 34 to 59 days of age, whereas the concentration decreased in the liver. The stereochemical composition of α-tocopherol showed a steep decrease in the concentration of the biologically most active natural isomer in both plasma and liver through the whole weaning period, whereas the biologically less active 2S isomers showed a clear increase. The concentration of bile salts did not change during the experimental period. The villous height increased in the proximal part of the small intestine and decreased in the distal part, whereas the crypt depth was doubled in both the proximal and distal part of the small intestine. The mucin-staining area on the villi was markedly reduced during the experimental period but no change in the mucin-staining area in the crypts was observed. 相似文献
13.
14.
Aims: To investigate the effects of simulated gastric conditions upon the anti-Helicobacter pylori effects of garlic oil (GO). Methods and Results: Time course viability experiments assessed the anti-H. pylori activity of GO (16 and 32 μg ml−1) in simulated gastric environments. Rapid anti-H. pylori action of GO was observed in artificial gastric juice. Mucus (1–5%) was strongly protective of H. pylori both alone and in the presence of GO, but its protective effect was antagonized by GO. Peptone (5–15 g l−1) caused a dose-dependent reduction in the anti-H. pylori activity of GO. Rapeseed oil (5·7–17 g l−1) greatly diminished the anti-H. pylori activity of GO. Dextrin (44 and 133 g l−1) exhibited direct anti-H. pylori effects and added to those of GO. Simulated meal mixtures decreased but did not eliminate the anti-H. pylori activity of 32 μg ml−1 GO. Conclusions: The anti-H. pylori activity of GO was noticeably affected by food materials and mucin. However, substantial activity remained under simulated gastric conditions. Further investigation of the therapeutic potential of GO against H. pylori is therefore warranted. Significance and Impact of the Study: Garlic oil may be useful as an alternative treatment against H. pylori, a major cause of gastrointestinal infections in humans. 相似文献
15.
Aya Shinozaki Tetsuo Ushiku Teppei Morikawa Rumi Hino Takashi Sakatani Hiroshi Uozaki Masashi Fukayama 《The journal of histochemistry and cytochemistry》2009,57(8):775-785
Epstein-Barr virus (EBV)-associated gastric carcinoma (GC) is a distinct subtype with characteristic clinicopathological features. To better characterize its cellular characteristics, 43 cases of EBV-associated GC, 68 cases of EBV-negative GC, and non-neoplastic gastric mucosa in adults and fetuses were examined immunohistochemically. We quantified the expression of the major tight-junction protein claudin (CLDN) -1, -3, -4, -7, and -18 together with gastric mucins (MUC5AC and MUC6), intestinal mucin (MUC2), and CD10. EBV-associated GC showed a high frequency of CLDN18 expression (84%) and a low frequency of CLDN3 expression (5%). This expression profile corresponded to that of normal gastric epithelium in adults and fetuses. Almost half of the EBV-associated GC cases demonstrated gastric mucin expression, whereas the other half lacked mucin or CD10 expression. In contrast, as demonstrated by the expression profiles of CLDN3 and CLDN18, EBV-negative GC comprised a heterogeneous group of four different CLDN phenotypes: gastric, intestinal, mixed, and an undifferentiated type with variable expression patterns of mucins. These results indicate that EBV-associated GC is considerably homogenous with regard to cellular differentiation and that it preserves well the nature of the cells of origin. EBV-associated GC may undergo distinct carcinogenic processes, which differ from those of EBV-negative GC. (J Histochem Cytochem 57:775–785, 2009) 相似文献
16.
Angela C. Evans Nicholas O. Fischer Edmond Y. Lau Matthew A. Coleman Paul Butler 《Protein science : a publication of the Protein Society》2018,27(3):780-789
Nanolipoprotein particles (NLPs), composed of membrane scaffold proteins and lipids, have been used to support membrane proteins in a native‐like bilayer environment for biochemical and structural studies. Traditionally, these NLPs have been prepared by the controlled removal of detergent from a detergent‐solubilized protein‐lipid mixture. Recently, an alternative method has been developed using direct cell‐free expression of the membrane scaffold protein in the presence of preformed lipid vesicles, which spontaneously produces NLPs without the need for detergent at any stage. Using SANS/SAXS, we show here that NLPs produced by this cell‐free expression method are structurally indistinguishable from those produced using detergent removal methodologies. This further supports the utility of single step cell‐free methods for the production of lipid binding proteins. In addition, detailed structural information describing these NLPs can be obtained by fitting a capped core‐shell cylinder type model to all SANS/SAXS data simultaneously. 相似文献
17.
《Structure (London, England : 1993)》2019,27(12):1782-1797.e7
- Download : Download high-res image (241KB)
- Download : Download full-size image
18.
Background: Helicobacter pylori colonize the mucus layer that covers the gastric epithelium and can cause gastritis, ulcers, and gastric cancer. Recently, Lactobacillus sp. have also been found to reside in this niche permanently. This study compares adhesive properties and proliferation of co‐isolated lactobacilli and H. pylori in the presence of mucins and investigates possibilities for lactobacilli‐mediated inhibition of H. pylori. Materials and methods: Binding and proliferation of four H. pylori and four Lactobacillus strains, simultaneously isolated after residing in the stomachs of four patients for >4 years, to human gastric mucins were investigated using microtiter‐based methods. Results: The H. pylori strains co‐isolated with lactobacilli exhibited the same mucin binding properties as demonstrated for H. pylori strains previously. In contrast, no binding to mucins was detected with the Lactobacillus strains. Proliferation of mucin‐binding H. pylori strains was stimulated by the presence of mucins, whereas proliferation of non‐binding H. pylori and Lactobacillus strains was unaffected. Associative cultures of co‐isolated H. pylori and Lactobacillus strains showed no inhibition of H. pylori proliferation because of the presence of whole bacteria or supernatant of lactobacilli. Conclusions: The presence of lactobacilli in the stomach did not select for different mucin binding properties of H. pylori, and Lactobacillus sp. did neither compete for binding sites nor inhibit the growth of co‐isolated H. pylori. The effects of human gastric mucins on H. pylori proliferation vary between strains, and the host–bacteria interaction in the mucus niche thus depends on both the H. pylori strain and the microenvironment provided by the host mucins. 相似文献
19.
AIMS: To determine if human noroviruses (NV) bind to histo-blood group antigens (HBGA) from pig gastric mucosa. METHODS AND RESULTS: An assay was developed to measure the inhibition of binding of recombinant norovirus-like particles (rNVLP) to HBGA in human saliva by porcine gastric mucin (PGM). The binding of rNVLP to HBGA could be inhibited by PGM in a dose-dependent pattern. Also, rNVLP could be captured effectively by PGM coated directly on plates and was detected by binding of polyclonal antibodies against rNVLP. Similarly, the binding of rNVLP to PGM could be inhibited effectively by HBGA in human saliva, and by Lewis b and Lewis d synthetic oligosaccharides (OS), but not inhibited effectively by an H3 OS or by purified bovine submaxillary gland mucin. Preincubation of rNVLPs with PGM completely inhibited their binding to human Caco-2 cells. CONCLUSIONS: PGM binds effectively to rNVLPs and competitively inhibits rNVLPs binding to human HBGA and Caco-2 cells. SIGNIFICANCE AND IMPACT OF THE STUDY: This is the first report of the binding of glycoproteins from animal gastric mucosa to human NVs. This study highlights the importance of further characterizing the NV incidence and infections in nonhuman animal hosts and the possibility that NV is a zoonotic disease. 相似文献
20.
Ricardo M. F. Leal Shirley Callow Phil Callow Matthew P. Blakeley Christine J. Cardin William A. Denny Susana C. M. Teixeira Edward P. Mitchell V. Trevor Forsyth 《Acta Crystallographica. Section D, Structural Biology》2010,66(11):1244-1248
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X‐ray techniques. Two distinct examples are given. The first is a single‐crystal study of an A‐DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X‐ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction. 相似文献