共查询到20条相似文献,搜索用时 31 毫秒
1.
Clusters of closely spaced oxidative DNA lesions present challenges to the cellular repair machinery. When located in opposing strands, base excision repair (BER) of such lesions can lead to double strand DNA breaks (DSB). Activation of BER and DSB repair pathways has been implicated in inducing enhanced expansion of triplet repeat sequences. We show here that energy coupling between distal lesions (8oxodG and/or abasic sites) in opposing DNA strands can be modulated by a triplet repeat bulge loop located between the lesion sites. We find this modulation to be dependent on the identity of the lesions (8oxodG vs. abasic site) and the positions of the lesions (upstream vs. downstream) relative to the intervening bulge loop domain. We discuss how such bulge loop‐mediated lesion crosstalk might influence repair processes, while favoring DNA expansion, the genotype of triplet repeat diseases. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 355–369, 2010. This article was originally published online as an acceptedpreprint. The “Published Online” date corresponds to the preprint version. You can reqest a copy of the preprint byemailing the Biopolymers editorial office at biopolymers@wiley.com 相似文献
2.
We previously developed a system to investigate the mechanism of repeat sequence expansion during eukaryotic Okazaki fragment processing. Upstream and downstream primers were annealed to a complementary template to overlap across a CAG repeat region. Annealing by the competing primers lead to structural intermediates that ligated to expand the repeat segment. When an equal number of repeats overlapped on the upstream and downstream primers, a 2-fold expansion was expected, but no expansion occurred. We show here that such substrates do not expand irrespective of their repeat length. To reveal mechanism, we tested different hairpin loop intermediates expected to form and facilitate ligation. Substrates configured to form large loops in either the upstream or downstream primer alone allowed expansion. Large or small fixed position single loops allowed expansion when located at least six nucleotides up- or downstream of the nick. Fixed loops in both primers, simulating a double loop intermediate, allowed expansion as long as each loop was nine nucleotides from the nick. Thus, neither the double loop configuration required to form with equal length overlaps nor the large single loop configuration are fundamental structural impediments to expansion. We propose a model for the expansion mechanism based on the relative stabilities of single loop, double loop, hairpin, and flap intermediates that is consistent with the observed expansion efficiency of equal and unequal overlap substrates. The model suggests that the equilibrium concentration of double loop intermediates is so vanishingly small that they are not likely contributors to sequence expansion. 相似文献
3.
Meng Xu Yanhao Lai Justin Torner Yanbin Zhang Zunzhen Zhang Yuan Liu 《Nucleic acids research》2014,42(6):3675-3691
Trinucleotide repeat (TNR) expansion is responsible for numerous human neurodegenerative diseases. However, the underlying mechanisms remain unclear. Recent studies have shown that DNA base excision repair (BER) can mediate TNR expansion and deletion by removing base lesions in different locations of a TNR tract, indicating that BER can promote or prevent TNR expansion in a damage location–dependent manner. In this study, we provide the first evidence that the repair of a DNA base lesion located in the loop region of a CAG repeat hairpin can remove the hairpin, attenuating repeat expansion. We found that an 8-oxoguanine located in the loop region of CAG hairpins of varying sizes was removed by OGG1 leaving an abasic site that was subsequently 5′-incised by AP endonuclease 1, introducing a single-strand breakage in the hairpin loop. This converted the hairpin into a double-flap intermediate with a 5′- and 3′-flap that was cleaved by flap endonuclease 1 and a 3′-5′ endonuclease Mus81/Eme1, resulting in complete or partial removal of the CAG hairpin. This further resulted in prevention and attenuation of repeat expansion. Our results demonstrate that TNR expansion can be prevented via BER in hairpin loops that is coupled with the removal of TNR hairpins. 相似文献
4.
McCann MD Lim GF Manni ML Estes J Klapec KA Frattini GD Knarr RJ Gratton JL Serra MJ 《RNA (New York, N.Y.)》2011,17(1):108-119
Thirty-one RNA duplexes containing single-nucleotide bulge loops were optically melted in 1 M NaCl, and the thermodynamic parameters ΔH°, ΔS°, ΔG°(37), and T(M) for each sequence were determined. The bulge loops were of the group II variety, where the bulged nucleotide is identical to one of its nearest neighbors, leading to ambiguity as to the exact position of the bulge. The data were used to develop a model to predict the free energy of an RNA duplex containing a single-nucleotide bulge. The destabilization of the duplex by the bulge was primarily related to the stability of the stems adjacent to the bulge. Specifically, there was a direct correlation between the destabilization of the duplex and the stability of the less stable duplex stem. Since there is an ambiguity of the bulge position for group II bulges, several different stem combinations are possible. The destabilization of group II bulge loops is similar to the destabilization of group I bulge loops, if the second least stable stem is used to predict the influence of the group II bulge. In-line structure probing of the group II bulge loop embedded in a hairpin indicates that the bulged nucleotide is the one positioned farther from the hairpin loop. 相似文献
5.
Jessica L. Kent Michael D. McCann Daniel Phillips Brandon L. Panaro Geoffrey F.S. Lim Martin J. Serra 《RNA (New York, N.Y.)》2014,20(6):825-834
Thirty-five RNA duplexes containing single nucleotide bulge loops were optically melted and the thermodynamic parameters for each duplex determined. The bulge loops were of the group III variety, where the bulged nucleotide is either a AG/U or CU/G, leading to ambiguity to the exact position and identity of the bulge. All possible group III bulge loops with Watson–Crick nearest-neighbors were examined. The data were used to develop a model to predict the free energy of an RNA duplex containing a group III single nucleotide bulge loop. The destabilization of the duplex by the group III bulge could be modeled so that the bulge nucleotide leads to the formation of the Watson–Crick base pair rather than the wobble base pair. The destabilization of an RNA duplex caused by the insertion of a group III bulge is primarily dependent upon non-nearest-neighbor interactions and was shown to be dependent upon the stability of second least stable stem of the duplex. In-line structure probing of group III bulge loops embedded in a hairpin indicated that the bulged nucleotide is the one positioned further from the hairpin loop irrespective of whether the resulting stem formed a Watson–Crick or wobble base pair. Fourteen RNA hairpins containing group III bulge loops, either 3′ or 5′ of the hairpin loop, were optically melted and the thermodynamic parameters determined. The model developed to predict the influence of group III bulge loops on the stability of duplex formation was extended to predict the influence of bulge loops on hairpin stability. 相似文献
6.
Claire Gaillard Luda S Shlyakhtenko Yuri L Lyubchenko Fran?ois Strauss 《BMC structural biology》2002,2(1):7-13
Background
We have previously isolated a stable alternative DNA structure, which was formed in vitro by reassociation of the strands of DNA fragments containing a 62 bp tract of the CA-microsatellite poly(CA)·poly(TG). In the model which was proposed for this structure the double helix is folded into a loop, the base of the loop consists of a DNA junction in which one of the strands of one duplex passes between the two strands of the other duplex, forming a DNA hemicatenane in a hemiknot structure. The hemiknot DNA structures obtained with long CA/TG inserts have been imaged by AFM allowing us to directly visualize the loops. 相似文献7.
Anna Rojowska Katja Lammens Florian U Seifert Carolin Direnberger Heidi Feldmann Karl‐Peter Hopfner 《The EMBO journal》2014,33(23):2847-2859
The Mre11–Rad50 nuclease–ATPase is an evolutionarily conserved multifunctional DNA double‐strand break (DSB) repair factor. Mre11–Rad50's mechanism in the processing, tethering, and signaling of DSBs is unclear, in part because we lack a structural framework for its interaction with DNA in different functional states. We determined the crystal structure of Thermotoga maritima Rad50NBD (nucleotide‐binding domain) in complex with Mre11HLH (helix‐loop‐helix domain), AMPPNP, and double‐stranded DNA. DNA binds between both coiled‐coil domains of the Rad50 dimer with main interactions to a strand‐loop‐helix motif on the NBD. Our analysis suggests that this motif on Rad50 does not directly recognize DNA ends and binds internal sites on DNA. Functional studies reveal that DNA binding to Rad50 is not critical for DNA double‐strand break repair but is important for telomere maintenance. In summary, we provide a structural framework for DNA binding to Rad50 in the ATP‐bound state. 相似文献
8.
Thermodynamic parameters based on a nearest-neighbor model for DNA sequences with a single-bulge loop 总被引:6,自引:0,他引:6
All 64 possible thermodynamic parameters for a single-bulge loop in the middle of a sequence were derived from optical melting studies. The relative stability of a single bulge depended on both the type of bulged base and its flanking base pairs. The contribution of the single bulge to helix stability ranged from 3.69 kcal/mol for a TAT bulge to -1.05 kcal/mol for an ACC bulge. Thermodynamics for 10 sequences with a GTG bulge were determined to test the applicability of the nearest-neighbor model to a single-bulge loop. Thermodynamic parameters for the GTG bulge and Watson-Crick base pairs predict, DeltaH degrees, DeltaS degrees, and T(M)(50 microM) values with average deviations of 3.0%, 4.3%, 4.7%, and 0.9 degrees C, respectively. The prediction accuracy was within the limits of what can be expected for a nearest-neighbor model. This certified that the thermodynamics for single-bulge loops can be estimated adequately using a nearest-neighbor model. 相似文献
9.
The crystal structure of the four-stranded DNA Holliday junction has now been determined in the presence and absence of junction binding proteins, with the extended open-X form of the junction seen in all protein complexes, but the more compact stacked-X structure observed in free DNA. The structures of the stacked-X junction were crystallized because of an unexpected sequence dependence on the stability of this structure. Inverted repeat sequences that contain the general motif NCC or ANC favor formation of stacked-X junctions, with the junction cross-over occurring between the first two positions of the trinucleotides. This review focuses on the sequence dependent structure of the stacked-X junction and how it may play a role in structural recognition by a class of dimeric junction resolving enzymes that themselves show no direct sequence recognition. 相似文献
10.
In the phenomenon of trinucleotide repeat (TNR) expansion, an important interplay exists between DNA damage repair of 8-oxo-7,8-dihydroguanine (8-oxoG) and noncanonical structure formation. We show that TNR DNA adapts its structure to accommodate 8-oxoG. Using chemical probe analysis, we find that CAG repeats composing the stem-loop arm of a three-way junction alter the population of structures in response to 8-oxoG by positioning the lesion at or near the loop. Furthermore, we find that oligonucleotides composed of odd-numbered repeat sequences, which form populations of two structures, will also alter their structure to place 8-oxoG in the loop. However, sequences with an even number of repeats do not display this behavior. Analysis by differential scanning calorimetry indicates that when the lesion is located within the loop, there are no significant changes to the thermodynamic parameters as compared to the DNA lacking 8-oxoG. This contrasts with the enthalpic destabilization observed when 8-oxoG is base-paired to C and indicates that positioning 8-oxoG in the loop avoids the thermodynamic penalty associated with 8-oxoG base-pairing. Since formation of stem-loop hairpins is proposed to facilitate TNR expansion, these results highlight the importance of defining the structural consequences of DNA damage. 相似文献
11.
12.
Triplet repeat DNA structures and human genetic disease: dynamic mutations from dynamic DNA 总被引:13,自引:0,他引:13
Richard R. Sinden Vladimir N. Potaman Elena A. Oussatcheva Christopher E. Pearson Yuri L. Lyubchenko Luda S. Shlyakhtenko 《Journal of biosciences》2002,27(1):53-65
Fourteen genetic neurodegenerative diseases and three fragile sites have been associated with the expansion of (CTG)n•(CAG)n, (CGG)n•(CCG)n, or (GAA)n•(TTC)n repeat tracts. Different models have been proposed for the expansion of triplet repeats, most of which presume the formation
of alternative DNA structures in repeat tracts. One of the most likely structures, slipped strand DNA, may stably and reproducibly
form within triplet repeat sequences. The propensity to form slipped strand DNA is proportional to the length and homogeneity
of the repeat tract. The remarkable stability of slipped strand DNA may, in part, be due to loop-loop interactions facilitated
by the sequence complementarity of the loops and the dynamic structure of three-way junctions formed at the loop-outs. 相似文献
13.
O. A. Vinogradova E. V. Eremeeva A. A. Lomzov I. A. Pyshnaya D.V. Pyshnyi 《Russian Journal of Bioorganic Chemistry》2009,35(3):349-359
An opportunity of designing nontypical double-stranded DNA structures containing nonnatural inserts in a regular nucleotide DNA sequence has been investigated. The looped nucleotide inserts on the basis of adenylates and thymidilates, and nonnucleotide inserts on the basis of phosphodiesters of diethyleneglycol, 1,10-decanediol, and 3-hydroxy-2(hydroxymethyl)tetrahydrofuran were introduced into the backbone of a 32-mer native DNA duplex. These inserts formed the internal loops in the modified double-stranded DNA fragments which were shown to lead to bending of the linear duplex structure by 16 to 83 degrees. The dependencies of the bend angle of dsDNA on the composition and the length of the looped regions were determined. It was established that the bend of the irregular region of dsDNA depended on the electrostatic interaction of the phosphate residues. The tension in the complex structure could be reduced by the introduction of additional nucleotide units opposite the loop, which led to some relaxation of the bent helix. The resulting parameters of the bend values were shown to be in a good agreement with the published data obtained by NMR spectroscopy. It was demonstrated that the variation of the nature or the length of the insert allowed one to regulate the level of the local perturbation of the duplex structure and, thereby, influence both the bend level of the double helix and the destabilization of the modified complex. 相似文献
14.
Non-nearest-neighbor dependence of the stability for RNA bulge loops based on the complete set of group I single-nucleotide bulge loops 总被引:1,自引:0,他引:1
Blose JM Manni ML Klapec KA Stranger-Jones Y Zyra AC Sim V Griffith CA Long JD Serra MJ 《Biochemistry》2007,46(51):15123-15135
Fifty-nine RNA duplexes containing single-nucleotide bulge loops were optically melted in 1 M NaCl, and the thermodynamic parameters DeltaH degrees, DeltaS degrees, DeltaG 37 degrees, and TM for each sequence were determined. Sequences from this study were combined with sequences from previous studies [Longfellow, C. E., et al. (1990) Biochemistry 29, 278-285; Znosko, B. M., et al. (2002) Biochemistry 41, 10406-10417], thus examining all possible group I single-nucleotide bulge loop and nearest-neighbor sequence combinations. The free energy increments at 37 degrees C for the introduction of a group I single-nucleotide bulge loop range between 1.3 and 5.2 kcal/mol. The combined data were used to develop a model for predicting the free energy of a RNA duplex containing a single-nucleotide bulge. For bulge loops with adjacent Watson-Crick base pairs, neither the identity of the bulge nor the nearest-neighbor base pairs had an effect on the influence of the bulge loop on duplex stability. The proposed model for prediction of the stability of a duplex containing a bulged nucleotide was primarily affected by non-nearest-neighbor interactions. The destabilization of the duplex by the bulge was related to the stability of the stems adjacent to the bulge. Specifically, there was a direct correlation between the destabilization of the duplex and the stability of the less stable duplex stem. The stability of a duplex containing a bulged nucleotide adjacent to a wobble base pair also was primarily affected by non-nearest-neighbor interactions. Again, there was a direct correlation between the destabilization of the duplex and the stability of the less stable duplex stem. However, when one or both of the bulge nearest neighbors was a wobble base pair, the free energy increment for insertion of a bulge loop is dependent upon the position and orientation of the wobble base pair relative the bulged nucleotide. Bulge sequences of the type ((5'UBX)(3'GY)), ((5'GBG)(3'UU)) and ((5'UBU)(3'GG)) are less destabilizing by 0.6 kcal/mol, and bulge sequences of the type ((5'GBX)(3'UY)) and ((5'XBU)(3'YG)) are more destabilizing by 0.4 kcal/mol than bulge loops adjacent to Watson-Crick base pairs. 相似文献
15.
L Joshua-Tor F Frolow E Appella H Hope D Rabinovich J L Sussman 《Journal of molecular biology》1992,225(2):397-431
The three-dimensional structure of a DNA tridecamer d(CGCAGAATTCGCG)2 containing bulged adenine bases was determined by single crystal X-ray diffraction methods, at 120 K, to 2.6 A resolution. The structure is a B-DNA type double helix with a single duplex in the asymmetric unit. One of the bulged adenine bases loops out from the double helix, while the other stacks in to it. This is in contrast to our preliminary finding, which indicated that both adenine bases were looped out. This revised model was confirmed by the use of a covalently bound heavy-atom derivative. The conformation of the looped-out bulge hardly disrupts base stacking interactions of the bases flanking it. This is achieved by the backbone making a "loop-the-loop" curve with the extra adenine flipping over with respect to the other nucleotides in the strand. The looped-out base intercalates into the stacked-in bulge site of a symmetrically related duplex. The looped-out and stacked-in bases form an A.A reversed Hoogsteen base-pair that stacks between the surrounding base-pairs, thus stabilizing both bulges. The double helix is frayed at one end with the two "melted" bases participating in intermolecular interactions. A related structure, of the same tridecamer, after soaking the crystals with proflavin, was determined to 3.2 A resolution. The main features of this B-DNA duplex are basically similar to the native tridecamer but differ in detail especially in the conformation of the bulged-out base. Accommodation of a large perturbation such as that described here with minimal disruption of the double helix shows both the flexibility and resiliency of the DNA molecule. 相似文献
16.
Joseph S. Xu Madeleine N. Hewitt Jaskeerat S. Gulati Matthew A. Cruz Hongli Zhan Shirley Liu Kathleen S. Matthews 《Protein science : a publication of the Protein Society》2018,27(4):839-847
The short 8–10 amino acid “hinge” sequence in lactose repressor (LacI), present in other LacI/GalR family members, links DNA and inducer‐binding domains. Structural studies of full‐length or truncated LacI‐operator DNA complexes demonstrate insertion of the dimeric helical “hinge” structure at the center of the operator sequence. This association bends the DNA ~40° and aligns flanking semi‐symmetric DNA sites for optimal contact by the N‐terminal helix‐turn‐helix (HtH) sequences within each dimer. In contrast, the hinge region remains unfolded when bound to nonspecific DNA sequences. To determine ability of the hinge helix alone to mediate DNA binding, we examined (i) binding of LacI variants with deletion of residues 1–50 to remove the HtH DNA binding domain or residues 1–58 to remove both HtH and hinge domains and (ii) binding of a synthetic peptide corresponding to the hinge sequence with a Val52Cys substitution that allows reversible dimer formation via a disulfide linkage. Binding affinity for DNA is orders of magnitude lower in the absence of the helix‐turn‐helix domain with its highly positive charge. LacI missing residues 1–50 binds to DNA with ~4‐fold greater affinity for operator than for nonspecific sequences with minimal impact of inducer presence; in contrast, LacI missing residues 1–58 exhibits no detectable affinity for DNA. In oxidized form, the dimeric hinge peptide alone binds to O1 and nonspecific DNA with similarly small difference in affinity; reduction to monomer diminished binding to both O1 and nonspecific targets. These results comport with recent reports regarding LacI hinge interaction with DNA sequences. 相似文献
17.
The three-dimensional solution structure of a DNA molecule of the sequence 5'-d(GCATCGAAAAAGCTACG)-3' paired with 5'-d(CGTAGCCGATGC)-3' containing a five-adenine bulge loop (dA(5)-bulge) between two double helical stems was determined by 2D (1)H and (31)P NMR, infrared, and Raman spectroscopy. The DNA in both stems adopt a classical B-form double helical structure with Watson-Crick base pairing and C2'-endo sugar conformation. In addition, the two dG/dC base pairs framing the dA(5)-bulge loop are formed and are stable at least up to 30 degrees C. The five adenine bases of the bulge loop are localized at intrahelical positions within the double helical stems. Stacking on the double helical stem is continued for the first four 5'-adenines in the bulge loop. The total rise (the height) of these four stacked adenines roughly equals the diameter of the double helical stem. The stacking interactions are broken between the last of these four 5'-adenines and the fifth loop adenine at the 3'-end. This 3'-adenine partially stacks on the other stem. The angle between the base planes of the two nonstacking adenines (A10 and A11) in the bulge loop reflects the kinking angle of the global DNA structure. The neighboring cytosines opposite the dA(5)-bulge (being parts of the bulge flanking base pairs) do not stack on one another. This disruption of stacking is characterized by a partial shearing of these bases, such that certain sequential NOEs for this base step are preserved. In the base step opposite the loop, an extraordinary hydrogen bond is observed between the phosphate backbone of the 5'-dC and the amino proton of the 3'-dC in about two-thirds of the conformers. This hydrogen bond probably contributes to stabilizing the global DNA structure. The dA(5)-bulge induces a local kink into the DNA molecule of about 73 degrees (+/-11 degrees ). This kinking angle and the mutual orientation of the two double helical stems agree well with results from fluorescence resonance energy transfer measurements of single- and double-bulge DNA molecules. 相似文献
18.
Andrei Kuzminov 《BioEssays : news and reviews in molecular, cellular and developmental biology》2013,35(4):306-313
Simple DNA repeats (trinucleotide repeats, micro‐ and minisatellites) are prone to expansion/contraction via formation of secondary structures during DNA synthesis. Such structures both inhibit replication forks and create opportunities for template‐primer slippage, making these repeats unstable. Certain aspects of simple repeat instability, however, suggest additional mechanisms of replication inhibition dependent on the primary DNA sequence, rather than on secondary structure formation. I argue that expanded simple repeats, due to their lower DNA complexity, should transiently inhibit DNA synthesis by locally depleting specific DNA precursors. Such transient inhibition would promote formation of secondary structures and would stabilize these structures, facilitating strand slippage. Thus, replication problems at simple repeats could be explained by potentiated toxicity, where the secondary structure‐driven repeat instability is enhanced by DNA polymerase stalling at the low complexity template DNA. This minireview is dedicated to the FASEB‐2012 meeting “Dynamic DNA Structures in Biology”, organized by Nancy Maizels and Sergei Mirkin. 相似文献
19.
Bulge loops are common features of RNA structures that are involved in the formation of RNA tertiary structures and are often sites for interactions with proteins and ions. Minimal thermodynamic data currently exist on the bulge size and sequence effects. Using thermal denaturation methods, thermodynamic properties of 1- to 5-nt adenine and guanine bulge loop constructs were examined in 10 mM MgCl2 or 1 M KCl. The loop parameters for 1- to 5-nt purine bulge loops in RNA constructs were between 3.07 and 5.31 kcal/mol in 1 M KCl buffer. In 10 mM magnesium ions, the ΔΔG° values relative to 1 M KCl were 0.47–2.06 kcal/mol more favorable for the RNA bulge loops. The loop parameters for 1- to 5-nt purine bulge loops in DNA constructs were between 4.54 and 5.89 kcal/mol. Only 4- and 5-nt guanine constructs showed significant change in stability for the DNA constructs in magnesium ions. A linear correlation is seen between the size of the bulge loop and its stability. New prediction models are proposed for 1- to 5-nt purine bulge loops in RNA and DNA in 1 M KCl. We show that a significant stabilization is seen for small bulge loops in RNA in the presence of magnesium ions. A prediction model is also proposed for 1- to 5-nt purine bulge loop RNA constructs in 10 mM magnesium chloride. 相似文献
20.
Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses. 总被引:1,自引:1,他引:0 下载免费PDF全文
M Merchlinsky 《Journal of virology》1990,64(10):5029-5035
In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. 相似文献