Phylogeny of the 5S ribosomal RNA fromSynechococcus lividus II: The cyanobacterial/chloroplast 5S RNAs form a common structural class

Summary The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacteriumSynechococcus lividus II has been determined. The sequence is 5-UGCCUAGUGUUUAUGGCGCG-GUGGAACCACGCUGAUCCAUCCCGAACUC-AGAGGUGAAACAUCGCAGCGGUGAAGAU-AGUUGGAGGGUAGCCUCCUGCAAAAAUA-GCUCAAUGCUAGGCA_OH-3. This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA ofS. lividus II has 27 base differences compared with the 5S RNA of the related strainS. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs fromS. lividus II,S. lividus III, and spinach chloroplasts are identical, but differ considerably from that ofEscherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA ofE. coli and these cyanobacterial and chloroplast 5S RNAs.     

Drosophila melanogaster has different ribosomal RNA sequences on S and Y chromosomes.

The primary structures of ribosomal RNAs transcribed from the nucleolus organizers on X and Y chromosomes of Drosophila melanogaster were compared by RNase T₁ fingerprints made with two different systems; i.e. homochromatography on DEAE-cellulose, and polyethyleneimine-cellulose thin-layer chromatography.Ribosomal RNA derived from the X-linked nucleolus organizer was obtained from a strain producing only female larvae and ribosomal RNA derived from the Y-linked nucleolus organizer was isolated from a mutant lacking the X-linked nucleolus organizer.No difference was detected between the fingerprints of 28 S RNA from these animals.In 18 S RNA, however, one oligonucleotide showed a remarkable difference in mobility. The structure of the X-linked organizer-specific oligonucleotide was 5′ U-C-U-U-U-U-U-U-C-C-U-A-U-G 3′, and that of the Y-linked organizer-specific oligonucleotide was 5′ U-C-U-C-U-U-U-U-C-C-U-A-U-G 3′, indicating one base substitution (U á3 C) between them.The absence of 5′-temninal phosphate in this oligonucleotide and available sequence data also suggest that these oligonucleotides did not come from either the 5′ or 3′ terminus of 18 S RNA.D. simulans, whose Y chromosome has no nucleolus organizer (Ritossa &; Atwood, 1966), showed an 18 S RNA fingerprint having only the X-linked organizer-specific oligonucleotide.We conclude from these results that in Drosophila the ribosomal RNA gene sequences are different for the two nucleolus organizers located on the X and Y chromosomes. The implications of those findings concerning the parallel evolution of these genes are discussed.     

Unusual 5 S ribosomal RNAs. An analysis of individual segments can reveal phylogenetic relatedness

Sequence comparisons of 5 S and other ribosomal RNAs by segments can be useful in understanding anomalous primary and secondary structures and in assessing phylogenetic relationships. In a segmented analysis, the 5'-half of the Chlamydomonas reinhardii chloroplast 5 S ribosomal RNA is found to have a very close sequence homology to the green plant chloroplast and cyanobacterial 5 S RNAs; however, the 3'-half has a highly unusual sequence. Further comparisons of homologies between regions of the 5 S RNAs from C. reinhardii and the green plant chloroplasts suggest that genetic rearrangements within the 5 S DNA may have produced the unusual sequence at the 3'-half. Segmented analyses of the C. reinhardii and green plant chloroplast 5 S RNAs suggest a close relationship which is not revealed by overall sequence comparisons.     

Composite structure of the chloroplast 23 S ribosomal RNA genes of Chlamydomonas reinhardii: Evolutionary and functional implications

The chloroplast ribosomal unit of Chlamydomonas reinhardii displays two features which are not shared by other chloroplast ribosomal units. These include the presence of an intron in the 23 S ribosomal RNA gene and of two small genes coding for 3 S and 7 S rRNA in the spacer between the 16 S and 23 S rRNA genes (Rochaix & Malnoë, 1978). Sequencing of the 7 S and 3 S rRNAs as well as their genes and neighbouring regions has shown that: (1) the 7 S and 3 S rRNA genes are 282 and 47 base-pairs long, respectively, and are separated by a 23 base-pair A + T-rich spacer. (2) A sequence microheterogeneity exists within the 3 S RNA genes. (3) The sequences of the 7 S and 3 S rRNAs are homologous to the 5′ termini of prokaryotic and other chloroplast 23 S rRNAs, indicating that the C. reinhardii counterparts of 23 S rRNA have a composite structure. (4) The sequences of the 7 S and 3 S rRNAs are related to that of cytoplasmic 5.8 S rRNA, suggesting that these RNAs may perform similar functions in the ribosome. (5) Partial nucleotide sequence complementarity is observed between the 5′ ends of the 7 S and 3 S RNAs on one hand and the 23 S rRNA sequences which flank the ribosomal intron on the other. These data are compatible with the idea that these small rRNAs may play a role in the processing of the 23 S rRNA precursor.     

Detection of specific sequences among DNA fragments separated by gel electrophoresis.

Ribosomal RNA and precursor ribosomal RNA from at least one representative of each vertebrate class have been analyzed by electron microscopic secondary structure mapping. Reproducible patterns of hairpin loops were found in both 28 S ribosomal and precursor ribosomal RNA, whereas almost all the 18 S ribosomal RNA molecules lack secondary structure under the spreading conditions used. The precursor ribosomal RNA of all species analyzed have a common design. The 28 S ribosomal RNA is located at or near the presumed 5′-end and is separated from the 18 S ribosomal RNA region by the internal spacer region. In addition there is an external spacer region at the 3′-end of all precursor ribosomal RNA molecules. Changes in the length of these spacer regions are mainly responsible for the increase in size of the precursor ribosomal RNA during vertebrate evolution. In cold blooded vertebrates the precursor contains two short spacer regions; in birds the precursor bears a long internal and a short external spacer region, and in mammals it has two long spacer regions. The molecular weights, as determined from the electron micrographs, are 2·6 to 2·8 × 10⁶ for the precursor ribosomal RNA of cold blooded vertebrates, 3·7 to 3·9 × 10⁶ for the precursor of birds, and 4·2 to 4·7 × 10⁶ for the mammalian precursor. Ribosomal RNA and precursor ribosomal RNA of mammals have a higher proportion of secondary structure loops when compared to lower vertebrates. This observation was confirmed by digesting ribosomal RNAs and precursor ribosomal RNAs with single-strandspecific S₁ nuclease in aqueous solution. Analysis of the double-stranded, S₁-resistant fragments indicates that there is a direct relationship between the hairpin loops seen in the electron microscope and secondary structure in aqueous solution.     

RNA--protein interactions in the ribosome. IV. Structure and properties of binding sites for proteins S4, S16/S17 and S20 in the 16S RNA

Proteins S4, S16/S17 and S20 of the 30 S ribosomal subunit of Escherichia coli+ associate with specific binding sites in the 16 S ribosomal RNA. A systematic investigation of the co-operative interactions that occur when two or more of these proteins simultaneously attach to the 16 S RNA indicate that their binding sites lie near to one another. The binding site for S4 has previously been located within a 550-nucleotide RNA fragment of approximately 9 S that arises from the 5′-terminal portion of the 16 S RNA upon limited hydrolysis with pancreatic ribonuclease. The 9 S RNA was unable to associate with S20 and S16/S17, however, either alone or in combination. A fragment of similar size and nucleotide sequence, termed the 9 S¹ RNA, has been isolated following ribonuclease digestion of the complex of 16 S RNA with S20 and S16/S17. The 9 S¹ RNA bound not only S4, but S20 and S16/S17 as well, although the fragment complex was stable only when both of the latter protein fractions were present together. Nonetheless, measurements of binding stoichiometry demonstrated the interactions to be specific under these conditions. A comparison of the 9 S and 9 S¹ RNAs by electrophoresis in polyacrylamide gels containing urea revealed that the two fragments differ substantially in the number and distribution of hidden breaks. Contrary to expectation, the RNA in the ribonucleoprotein complex appeared to be more accessible to ribonuclease than the free 16 S RNA as judged by the smaller average length of the sub-fragments recovered from the 9 S¹ RNA. These results suggest that the binding of S4, S16/S17 and S20 brings about a conformational alteration within the 5′ third of the 16 S RNA.To delineate further the portions of the RNA chain that interact with S4, S16/S17 and S20, specific fragments encompassing subsequences from the 5′ third of the 16 S RNA were sought. Two such fragments, designated 12 S-I and 12 S-II, were purified by polyacrylamide gel electrophoresis from partial T₁ ribonuclease digests of the 16 S RNA. The two RNAs, which contain 290 and 210 nucleotides, respectively, are contiguous and together span the entire 5′-terminal 500 residues of the 16 S RNA molecule. When tested individually, neither 12 S-I nor 12 S-II bound S4, S16/S17 or S20. If heated together at 40 °C in the presence of Mg²⁺ ions, however, the two fragments together formed an 8 S complex which associated with S4 alone, with S16/S17 + S20 in combination, and with S4 + S16/S17 + S20 when incubated with an un fractionated mixture of 30 S subunit proteins. These results imply that each fragment contains part of the corresponding binding sites.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Higher-order structure in the 3′-terminal domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus

An experimental approach was used to determine, and compare, the higher-order structure within domain VI of the 23 S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus. This domain, which encompasses approximately 300 nucleotides at the 3′ end of the RNAs, consists of two large subdomains. The 5′ subdomain has been conserved during evolution and appears to be functionally important for the binding of the EF-1 · GTP · aminoacyl-tRNA complex in eukaryotes. The 3′ subdomain has diverged widely between eubacteria and eukaryotes and has produced the 4.5 S RNA in the chloroplast ribosomes of flowering plants.The structure of domain VI within the eubacterial RNAs was probed with chemical reagents in order to establish the degree of stacking and/or accessibility of each adenosine, cytidine and guanosine residue; the double-helical segments were localized with the cobra venom ribonuclease from Naja naja oxiana, and the relatively unstructured and accessible sequences were detected with the single-strand-specific ribonucleases A, T₁ and T₂. The data enabled the three secondary structural models, proposed for the E. coli 23 S RNAs, to be examined critically and it was concluded that many of their structural features are correct. Various differences between the models were considered and evidence is provided for additional structuring in the RNA including the stacking of juxtaposed purines into double helices. The 5′ subdomain constitutes a compact and resistant structure whereas the 3′ subdomain is relatively accessible and contains most of the potential protein binding sites. Moreover, comparison of our results with the published results on 4.5 S RNA suggests that the latter forms essentially the same structure as the 3′ subdomain, in contrast to earlier conclusions.A high level of structural conservation has occurred throughout the RNA domain during the evolution of the Gram negative and Gram positive bacteria although the thermophile was generally more stable at base-pairs adjacent to the terminal loops.     

Extreme ends of the genome are conserved and rearranged in the defective interfering RNAs of semliki forest virus

We have analyzed Semliki Forest virus defective interfering RNA molecules, generated by serial undiluted passaging of the virus in baby hamster kidney cells. The 42 S RNA genome (about 13 kb ²) has been greatly deleted to generate the DI RNAs, which are heterogeneous both in size (about 2 kb) and sequence content. The DI RNAs offer a system for exploring binding sites for RNA polymerase and encapsidation signals, which must have been conserved in them since they are replicated and packaged. In order to study the structural organization of DI RNAs, and to analyze which regions from the genome have been conserved, we have determined the nucleotide sequences of (1) a 2.3 kb long DI RNA molecule, DI309, (2) 3′-terminal sequences (each about 0.3 kb) of two other DI RNAs, and (3) the nucleotide sequence of 0.4 kb at the extreme 5′ end of the 42 S RNA genome.The DI309 molecule consists of a duplicated region with flanking unique terminal sequences. A 273-nucleotide sequence is present in four copies per molecule. The extreme 5′-terminal nucleotide sequence of the 42 S RNA genome is shown to contain domains that are conserved in the two DI RNAs of known structure: DI309, and the previously sequenced DI301 (Lehtovaara et al., 1981). Here we report which terminal genome sequences are conserved in the DI RNAs, and how they have been modified, rearranged or amplified.     

A common conformational feature in several prokaryotic and eukaryotic 5 S RNAs: a highly exposed, single-stranded loop around position 40

Psendomonas fluorescens, yeast and HeLa cells ³²P-labelled 5 S RNAs were submitted to partial hydrolysis with T₁, T₂ or pancreatic ribonucleases; the fragments were separated by two-dimensional acrylamide gel electrophoresis. First splits (obtained when only one cleavage takes place in the molecule) were found to occur essentially around position 40 in the sequence, as already demonstrated for Escherichia coli 5 S RNA. The existence in prokaryotic and eukaryotic 5 S RNAs of this very accessible region is thus proved. Eukaryotic 5 S RNAs also display a very accessible region around position 90 of the sequence.     

Evolution of green plants and their relationship with other photosynthetic eukaryotes as deduced from 5S ribosomal RNA sequences

The nucleotide sequence of cytoplasmic 5S ribosomal RNAs from three gymnosperms,Pinus contorta, Taxus baccata andJuniperus media and from one fern,Pteridium aquilinum, have been determined. These sequences were aligned with all hitherto known cytoplasmic 5S ribosomal RNA sequences of photosynthetic eukaryotes. A dendrogram based on that set of sequences was constructed by a distance matrix method and the resulting tree compared with established views concerning plant and algal evolution. The following monophyletic groups of photosynthetic eukaryotes are recognizable: theRhodophyta, a group consisting ofPhaeophyta, Bacillariophyta andChrysophyta, and the green plants, the latter comprising green algae,Bryophyta, Pteridophyta andSpermatophyta. According to our 5S ribosomal RNA tree, green plants may have originated from some type of a green flagellated organism such asChlamydomonas. The land plants seem to have originated from some form of charophyte such asNitella. 5S ribosomal RNA seems to be less appropriate to estimate dissimilarities between species which have diverged relatively recently, like the angiosperms. Therefore, a precise evolutionary process is difficult to reconstruct for members of this group.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Nucleotide sequence of nuclear 5S RNA of mouse cells

The nucleotide sequence of nuclear 5S RNA of mouse cells was determined. The 5S RNA is 117 nucleotides long with one mole each of m₃^2,2,7G, Gm, Am and Cm, two moles of Um, and three moles of ψ as modified nucleosides, and it is rich in uridylate residues (about 36 %). The 5′-terminal hexanucleotide-containing cap structure, m₃^2,2,7GpppAm-Um-A-C-U-, is identical with that of U1 RNA. This RNA contains sequences complementary to the terminal sequences of the introns of heterogeneous nuclear RNAs.     

Structure analysis of three T7 late mRNA ribosome binding sites

The 5′-terminal regions of the three T7 late RNA species IIIb, IV and V have been characterized. These regions contain the protein synthesis initiation sites for the T7 genes 17, 9 and 10, respectively. Each of these is located between 60 and 90 nucleotides from the 5′ terminus of an in vitro synthesized RNA species. The sequence 5′ A-C-U-U-U-A-A-G-Pu-A-G-Pu, which is common to these ribosome binding regions, contains an impressive stretch of complementarity to the sequence 5′ A-C-C-U-C-C-U-U-A, at the 3′ terminus of 16 S ribosomal RNA. The nuclease mapping technique of Wurst et al. (1978) has been used to probe intramolecular structural interactions involving these initiation regions in the RNA. My results indicate that all three initiation codons, together with other portions of the ribosome binding regions are protected, under non-denaturing conditions, against the actions of both the single-strand-specific nuclease S₁ and RNAase T₁.     

The size and genetic composition of virus-specific RNAs in the cytoplasm of cells producing avian sarcoma-leukosis viruses.

The genome of avian sarcoma virus (ASV) contains four known genes: gag, encoding structural proteins of the viral core; pol, encoding the viral RNA-directed DNA polymerase; env, encoding the glycoprotein(s) of the viral envelope; and src, which is responsible for neoplastic transformation of the host cell. We have located these genes on virus-specific RNAs in cells productively infected with both nondefective and defective strains of ASV by using molecular hybridization with DNAs complementary to specific portions of the ASV genome.The cytoplasm of cells producing nondefective ASV contains three species of polyadenylated virus-specific RNA, each of which has chemical polarity identical to that of the viral genome. The largest species has a molecular weight of 3.3 × 10⁶ daltons and a sedimentation coefficient of 38S, encodes all four viral genes, and is probably identical to the viral genome. A second species has a molecular weight of 1.8 × 10⁶ daltons and a sedimentation coefficient of 28S, and encodes the 3′ half of the viral genome, including env, src and a genetically silent region known as “c.” The smallest species has a molecular weight of 1.2 × 10⁶ daltons and a sedimentation coefficient of 21S, and encodes only src and “c.” All three species of virus-specific RNA contain nucleotide sequences at least partially homologous to a sequence of 101 nucleotides found at the extreme 5′ end of the ASV genome. This sequence may not be present in the portions of the ASV genome which encode the 28S and 21S virus-specific RNAs, and hence may be joined to these RNAs during their maturation from precursor molecules.The size and genetic composition of virus-specific RNAs in cells producing defective deletion mutants reflect the nature of the deletion. Deletions of either src or env eliminate the 28S virus-specific RNA, leaving a 21S RNA (which contains either env and “c” in the case of src deletions or src and “c” in the case of env deletions) and a 35S RNA which is probably identical to the viral genome.Based on these and related results, we propose a model for viral gene expression which conforms to previous suggestions that eucaryotic cells initiate translations only at the 5′ termini of messenger RNAs.     

3′-terminal conserved loops of 16S rRNAs from the cyanobacterium Synechococcus an PCC 6301 and maize chloroplast differ only in two bases

The sequence of the 3′-terminal 43 nucleotides of 16S ribosomal RNA from the cyanobacterium Synechococcus AN PCC 6301 has been determined. This sequence is almost identical with the 3′-terminal sequence of 16S ribosomal RNA from maize chloroplasts. The evolutionary implications of these observations are discussed.