Trefusiidae Are a Subtaxon of Marine Enoplida (Nematoda): Evidence from Primary Structure of Hairpin 35 and 48 Loops of SSU rRNA Gene

A rare nucleotide substitution was found in the evolutionarily conserved loop of hairpin 35 of the 18S rRNA gene of marine free-living nematode, Trefusia zostericola(Nematoda: Enoplida). The same substitution was found in all the marine Enoplida studied but not in other nematodes. Such a molecular synapomorphy indicates that marine enoplids are more closely related to T. zostericolathan to freshwater Triplonchida. Maximum parsimony, neighbor-joining, and maximum likelihood analyses of complete nucleotide sequences of the gene, with the heterogeneity of nucleotide sites in evolution rates taken into account, support this conclusion. Hence, the hypothesis of particular primitiveness of Trefusiidae among nematodes should be rejected. Phylogenies based on molecular data support the morphological reduction of metanemes in Trefusiidae. Alongside with the unique change in hairpin 35 loop among marine Enoplida (including T. zostericola), hairpin 48 is also modified by a rare transversion which could be found among Mesorhabditoidea nematodes, in related genera Pelodera, Mesorhabditis, Teratorhabditis, Parasitorhabditis, Crustorhabditis, and Distolabrellus, and in 11 orders of Rhodophyta. Rare mutations in hairpins 35 and 48 tend to be fixed correlatively in evolution and could be found in all the Acanthocephala species. X-Ray data show that these regions (H31 and H43, in alternative nomenclature) are spatially brought together in native ribosomes. The nature and distribution of molecular autoapomorphies in phylogenetic trees of high-rank taxa are discussed.     

Structural characterisation of a uracil containing hairpin DNA by NMR and molecular dynamics.

Three-dimensional (3D) structure of a hairpin DNA d-CTAGAGGATCCTTTUGGATCCT (22mer; abbreviated as U4-hairpin), which has a uracil nucleotide unit at the fourth position from the 5' end of the tetra-loop has been solved by NMR spectroscopy. The(1)H resonances of this hairpin have been assigned almost completely. NMR restrained molecular dynamics and energy minimisation procedures have been used to describe the 3D structure of the U4 hairpin. This study establishes that the stem of the hairpin adopts a right handed B-DNA conformation while the T(12)and U(15)nucleotide stack upon 3' and 5' ends of the stem, respectively. Further, T(14)stacks upon both T(12)and U(15)while T(13)partially stacks upon T(14). Very weak stacking interaction is observed between T(13)and T(12). All the individual nucleotide bases adopt ' anti ' conformation with respect to their sugar moiety. The turning phosphate in the loop is located between T(13)and T(14). The stereochemistry of U(15)mimics the situation where uracil would stack in a B-DNA conformation. This could be the reason as to why the U4-hairpin is found to be the best substrate for its interaction with uracil DNA glycosylase (UDG) compared to the other substrates in which the uracil is at the first, second and third positions of the tetra-loop from its 5' end, as reported previously.     

Recognition elements in rRNA for the tylosin resistance methyltransferase RlmA(II)

The methyltransferase RlmA(II) (formerly TlrB) is found in many Gram-positive bacteria, and methylates the N-1 position of nucleotide G748 within the loop of hairpin 35 in 23S rRNA. Methylation of the rRNA by RlmA(II) confers resistance to tylosin and other mycinosylated 16-membered ring macrolide antibiotics. We have previously solved the solution structure of hairpin 35 in the conformation that is recognized by the RlmA(II) methyltransferase from Streptococcus pneumoniae. It was shown that while essential recognition elements are located in hairpin 35, the interactions between RlmA(II) and hairpin 35 are insufficient on their own to support the methylation reaction. Here we use biochemical techniques in conjunction with heteronuclear/homonuclear nuclear magnetic resonance spectroscopy to define the RNA structures that are required for efficient methylation by RlmA(II). Progressive truncation of the rRNA substrate indicated that multiple contacts occur between RlmA(II) and nucleotides in stem-loops 33, 34 and 35. RlmA(II) appears to recognize its rRNA target through specific surface shape complementarity at the junction formed by these three helices. This means of recognition is highly similar to that of the orthologous Gram-negative methyltransferase, RlmA(I) (formerly RrmA), which also interacts with hairpin 35, but methylates at the adjacent nucleotide G745.     

Molecular evolutionary analysis of a histone gene repeating unit from Drosophila simulans

A repeating unit of the histone gene cluster from Drosophila simulans containing the H1, H2A, H2B and H4 genes (the H3 gene region has already been analyzed) was cloned and analyzed. A nucleotide sequence of about 4.6 kbp was determined to study the nucleotide divergence and molecular evolution of the histone gene cluster. Comparison of the structure and nucleotide sequence with those of Drosophila melanogaster showed that the four histone genes were located at identical positions and in the same directions. The proportion of different nucleotide sites was 6.3% in total. The amino acid sequence of H1 was divergent, with a 5.1% difference. However, no amino acid change has been observed for the other three histone proteins. Analysis of the GC contents and the base substitution patterns in the two lineages, D. melanogaster and D. simulans, with a common ancestor showed the following. 1) A strong negative correlation was found between the GC content and the nucleotide divergence in the whole repeating unit. 2) The mode of molecular evolution previously found for the H3 gene was also observed for the whole repeating unit of histone genes; the nucleotide substitutions were stationary in the 3' and spacer regions, and there was a directional change of the codon usage to the AT-rich codons. 3) No distinct difference in the mode or pattern of molecular evolution was detected for the histone gene repeating unit in the D. melanogaster and D. simulans lineages. These results suggest that selectional pressure for the coding regions of histones, which eliminate A and T, is less effective in the D. melanogaster and D. simulans lineages than in the other GC-rich species.     

Rates of nucleotide substitution in Cornaceae (Cornales)-Pattern of variation and underlying causal factors

Identifying causes of genetic divergence is a central goal in evolutionary biology. Although rates of nucleotide substitution vary among taxa and among genes, the causes of this variation tend to be poorly understood. In the present study, we examined the rate and pattern of molecular evolution for five DNA regions over a phylogeny of Cornus, the single genus of Cornaceae. To identify evolutionary mechanisms underlying the molecular variation, we employed Bayesian methods to estimate divergence times and to infer how absolute rates of synonymous and nonsynonymous substitutions and their ratios change over time. We found that the rates vary among genes, lineages, and through time, and differences in mutation rates, selection type and intensity, and possibly genetic drift all contributed to the variation of substitution rates observed among the major lineages of Cornus. We applied independent contrast analysis to explore whether speciation rates are linked to rates of molecular evolution. The results showed no relationships for individual genes, but suggested a possible localized link between species richness and rate of nonsynonymous nucleotide substitution for the combined cpDNA regions. Furthermore, we detected a positive correlation between rates of molecular evolution and morphological change in Cornus. This was particularly pronounced in the dwarf dogwood lineage, in which genome-wide acceleration in both molecular and morphological evolution has likely occurred.     

An RNA conformational shift in recent H5N1 influenza A viruses

Recent outbreaks of avian influenza are being caused by unusually virulent H5N1 strains. It is unknown what makes these recent H5N1 strains more aggressive than previously circulating strains. Here, we have compared more than 3000 RNA sequences of segment 8 of type A influenza viruses and found a unique single nucleotide substitution typically associated with recent H5N1 strains. By phylogenetic analysis, biochemical and biophysical experiments, we demonstrate that this substitution dramatically affects the equilibrium between a hairpin and a pseudoknot conformation near the 3' splice-site of the NS gene. This conformational shift may have consequences for splicing regulation of segment 8 mRNA. Our data suggest that besides changes at the protein level, changes in RNA secondary structure should be seriously considered when attempting to explain influenza virus evolution. Supplementary information: Supplementary data are available at Bioinformatics online.     

Comparison of solution conformations and stabilities of modified helix 69 rRNA analogs from bacteria and human

The helix 69 (H69) region of the large subunit (28S) ribosomal RNA (rRNA) of Homo sapiens contains five pseudouridine (Ψ) residues out of 19 total nucleotides, three of which are highly conserved. In this study, the effects of this abundant modified nucleotide on the structure and stability of H69 were compared with those of uridine in double-stranded (stem) regions. These results were compared with previous hairpin (stem plus single-stranded loop) studies to understand the contributions of the loop sequences to H69 structure and stability. The role of a loop nucleotide substitution from an A in bacteria (position 1918 in Escherichia coli 23S rRNA) to a G in eukaryotes (position 3734 in H. sapiens 28S rRNA) was examined. Thermodynamic parameters for the duplex RNAs were obtained through UV melting studies, and differences in the modified and unmodified RNA structures were examined by circular dichroism spectroscopy. The overall folded structure of human H69 appears to be similar to the bacterial RNA, consistent with the idea that ribosome structure and function are highly conserved; however, our results reveal subtle differences in structure and stability between the bacterial and human H69 RNAs in both the stem and loop regions. These findings may be significant with respect to H69 as a potential drug target site.     

Structural characterization of a six-nucleotide RNA hairpin loop found in Escherichia coli, r(UUAAGU)

The binding region of the Escherichia coli S2 ribosomal protein contains a conserved UUAAGU hairpin loop. The structure of the hairpin formed by the oligomer r(GCGU4U5A6A7G8U9CGCA), which has an r(UUAAGU) hairpin loop, was determined by NMR and molecular modeling techniques as part of a study aimed at characterizing the structure and thermodynamics of RNA hairpin loops. Thermodynamic data obtained from melting curves for this RNA oligomer show that it forms a hairpin in solution with the following parameters: DeltaH degrees = -42.8 +/- 2.2 kcal/mol, DeltaS degrees = -127.6 +/- 6.5 eu, and DeltaG degrees (37) = -3.3 +/- 0.2 kcal/mol. Two-dimensional NOESY WATERGATE spectra show an NOE between U imino protons, which suggests that U4 and U9 form a hydrogen bonded U.U pair. The U5(H2') proton shows NOEs to both the A6(H8) proton and the A7(H8) proton, which is consistent with formation of a "U" turn between nucleotides U5 and A6. An NOE between the A7(H2) proton and the U9(H4') proton shows the proximity of the A7 base to the U9 sugar, which is consistent with the structure determined for the six-nucleotide loop. In addition to having a hydrogen-bonded U.U pair as the first mismatch and a U turn, the r(UUAAGU) loop has the G8 base protruding into the solvent. The solution structure of the r(UUAAGU) loop is essentially identical to the structure of an identical loop found in the crystal structure of the 30S ribosomal subunit where the guanine in the loop is involved in tertiary interactions with RNA bases from adjacent regions [Wimberly, B. T., Brodersen, D. E., Clemons, W. M., Morgan-Warren, R. J., Carter, A. P., Vonrhein, C., Hartsch, T., and Ramakrishnan, V. (2000) Nature 407, 327-339]. The similarity of the solution and solid-state structures of this hairpin loop suggests that formation of this hairpin may facilitate folding of 16S RNA.     

Perturbation of DNA hairpins containing the EcoRI recognition site by hairpin loops of varying size and composition: physical (NMR and UV) and enzymatic (EcoRI) studies.

We have investigated loop-induced structural perturbation of the stem structure in hairpins d(GAATTCXnGAATTC) (X = A, T and n = 3, 4, 5 and 6) that contain an EcoRI restriction site in close proximity to the hairpin loop. Oligonucleotides containing either a T3 or a A3 loop were not hydrolyzed by the restriction enzyme and also showed only weak binding to EcoRI in the absence of the cofactor Mg2+. In contrast, hairpins with larger loops are hydrolyzed by the enzyme at the scission site next to the loop although the substrate with a A4 loop is significantly more resistant than the oligonucleotide containing a T4 loop. The hairpin structures with 3 loop residues were found to be thermally most stable while larger hairpin loops resulted in structures with lower melting temperatures. The T-loop hairpins are thermally more stable than the hairpins containing the same number of A residues in the loop. As judged from proton NMR spectroscopy and the thermodynamic data, the base pair closest to the hairpin loop did form in all cases studied. The hairpin loops did, however, affect the conformation of the stem structure of the hairpins. From 31P and 1H NMR spectroscopy we conclude that the perturbation of the stem structure is stronger for smaller hairpin loops and that the extent of the perturbation is limited to 2-3 base pairs for hairpins with T3 or A4 loops. Our results demonstrate that hairpin loops modulate the conformation of the stem residues close to the loop and that this in turn reduces the substrate activity for DNA sequence specific proteins.     

Moving towards a complete molecular framework of the Nematoda: a focus on the Enoplida and early-branching clades

Background  

The subclass Enoplia (Phylum Nematoda) is purported to be the earliest branching clade amongst all nematode taxa, yet the deep phylogeny of this important lineage remains elusive. Free-living marine species within the order Enoplida play prominent roles in marine ecosystems, but previous molecular phylogenies have provided only the briefest evolutionary insights; this study aimed to firmly resolve internal relationships within the hyper-diverse but poorly understood Enoplida. In addition, we revisited the molecular framework of the Nematoda using a rigorous phylogenetic approach in order to investigate patterns of early splits amongst the oldest lineages (Dorylaimia and Enoplia).     

Stability of single-nucleotide bulge loops embedded in a GAAA RNA hairpin stem

Forty-six RNA hairpins containing combinations of 3' or 5' bulge loops and a 3' or 5' fluorescein label were optically melted in 1 M NaCl, and the thermodynamic parameters ΔH°, ΔS°, ΔG°(37), and T(M) for each hairpin were determined. The bulge loops were of the group I variety, in which the identity of the bulge is known, and the group II variety, in which the bulged nucleotide is identical to one of its nearest neighbors, leading to ambiguity as to the exact position of the bulge. The fluorescein label at either the 3' end or 5' end of the hairpin did not significantly influence the stability of the hairpin. As observed with bulge loops inserted into a duplex motif, the insertion of a bulge loop into the stem of a hairpin loop was destabilizing. The model developed to predict the influence of bulge loops on the stability of duplex formation was extended to predict the influence of bulge loops on hairpin stability. Specifically, the influence of the bulge is related to the stability of the hairpin stem distal from the hairpin loop.     

Structure of 23S rRNA hairpin 35 and its interaction with the tylosin-resistance methyltransferase RlmAII

The bacterial rRNA methyltransferase RlmAII (formerly TlrB) contributes to resistance against tylosin-like 16-membered ring macrolide antibiotics. RlmAII was originally discovered in the tylosin-producer Streptomyces fradiae, and members of this subclass of methyltransferases have subsequently been found in other Gram-positive bacteria, including Streptococcus pneumoniae. In all cases, RlmAII methylates 23S rRNA at nucleotide G748, which is situated in a stem-loop (hairpin 35) at the macrolide binding site of the ribosome. The conformation of hairpin 35 recognized by RlmAII is shown here by NMR spectroscopy to resemble the anticodon loop of tRNA. The loop folds independently of the rest of the 23S rRNA, and is stabilized by a non-canonical G-A pair and a U-turn motif, rendering G748 accessible. Binding of S.pneumoniae RlmAII induces changes in NMR signals at specific nucleotides that are involved in the methyltransferase-RNA interaction. The conformation of hairpin 35 that interacts with RlmAII is radically different from the structure this hairpin adopts within the 50S subunit. This indicates that the hairpin undergoes major structural rearrangement upon interaction with ribosomal proteins during 50S assembly.     

Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms

The nucleotide sequence of ribosomal 5 S RNA from a halophilic bacterium, Halobacterium cutirubrum, grown in 4 M sodium chloride is U-U-A-A-G-G-C-G-G-C-C-A-U-A-G-C-G-G-U-G-G-G-G-U-U-A-C-U-C-C-C-G-U-A-C-C-C-A-U-C-C-C-G-A-A-C-A-C-G-G-A-A-G-A-U-A-A-G-C-C-C-G-C-C-U-G-C-G-U-U-C-C-G-G-U-C-A-G-U-A-C-U-G-G-A-G-U-G-C-G-A-G-C-C-U-C-U-G-G-G-A-A-A-U-C-C-G-G-U-U-C-G-C-C-G-C-C-U-A-C-U. This nucleotide sequence is the longest prokaryotic 5 S rRNA to be reported and unlike other 5 S species does not contain a terminal mononucleoside diphosphate residue at its 5'-end. When compared to other 5 S rRNA's, the sequence homology is greatest (about 68%) with Bacillus subtilis; there is a lower but similar degree of homology (about 58%) with either Escherichia coli or human 5 S RNA. The comparisons further indicate that among 5 S RNA's, eleven of the nucleotide residues are unique to H. cutirubrum. Estimates of the secondary structure of the H. cutirubrum 5 S RNA molecule contain one additional stable hairpin loop which is not found in other 5 S rRNA species; this unusual structure is probably an adaptation to the high salt environment within H. cutirubrum cells.     

Nucleotide analog interference mapping of the hairpin ribozyme: implications for secondary and tertiary structure formation.

The hairpin ribozyme is a small, naturally occurring RNA capable of folding into a distinct three-dimensional structure and catalyzing a specific phosphodiester transfer reaction. We have adapted a high throughput screening procedure entitled nucleotide analog interference mapping (NAIM) to identify functional groups important for proper folding and catalysis of this ribozyme. A total of 18 phosphorothioate-tagged nucleotide analogs were used to determine the contribution made by individual ribose 2'-OH and purine functional groups to the hairpin ribozyme ligation reaction. Substitution with 2'-deoxy-nucleotide analogs disrupted activity at six sites within the ribozyme, and a unique interference pattern was observed at each of the 11 conserved purine nucleotides. In most cases where such information is available, the NAIM data agree with the previously reported single-site substitution results. The interference patterns are interpreted in comparison to the isolated loop A and loop B NMR structures and a model of the intact ribozyme. These data provide biochemical evidence in support of many, but not all, of the non-canonical base-pairs observed by NMR in each loop, and identify the functional groups most likely to participate in the tertiary interface between loop A and loop B. These groups include the 2'-OH groups of A10, G11, U12, C25, and A38, the exocyclic amine of G11, and the minor groove edge of A9 and A24. The data also predict non-A form sugar pucker geometry at U39 and U41. Based upon these results, a revised model for the loop A tertiary interaction with loop B is proposed. This work defines the chemical basis of purine nucleotide conservation in the hairpin ribozyme, and provides a basis for the design and interpretation of interference suppression experiments.     

An improved molecular phylogeny of the Nematoda with special emphasis on marine taxa

Phylogenetic reconstructions of relations within the phylum Nematoda are inherently difficult but have been advanced with the introduction of large-scale molecular-based techniques. However, the most recent revisions were heavily biased towards terrestrial and parasitic species and greater representation of clades containing marine species (e.g. Araeolaimida, Chromadorida, Desmodorida, Desmoscolecida, Enoplida, and Monhysterida) is needed for accurate coverage of known taxonomic diversity. We now add small subunit ribosomal DNA (SSU rDNA) sequences for 100 previously un-sequenced species of nematodes, including 46 marine taxa. SSU rDNA sequences for >200 taxa have been analysed based on Bayesian inference and LogDet-transformed distances. The resulting phylogenies provide support for (i) the re-classification of the Secernentea as the order Rhabditida that derived from a common ancestor of chromadorean orders Araeolaimida, Chromadorida, Desmodorida, Desmoscolecida, and Monhysterida and (ii) the position of Bunonema close to the Diplogasteroidea in the Rhabditina. Other, previously controversial relationships can now be resolved more clearly: (a) Alaimus, Campydora, and Trischistoma belong in the Enoplida, (b) Isolaimium is placed basally to a big clade containing the Axonolaimidae, Plectidae, and Rhabditida, (c) Xyzzors belongs in the Desmodoridae, (d) Comesomatidae and Cyartonema belongs in the Monhysterida, (e) Globodera belongs in the Hoplolaimidae and (f) Paratylenchus dianeae belongs in the Criconematoidea. However, the SSU gene did not provide significant support for the class Chromadoria or clear evidence for the relationship between the three classes, Enoplia, Dorylaimia, and Chromadoria. Furthermore, across the whole phylum, the phylogenetically informative characters of the SSU gene are not informative in a parsimony analysis, highlighting the short-comings of the parsimony method for large-scale phylogenetic modelling.     

Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.     

Mutational Analysis of the mRNA Operator for T4 DNA Polymerase

Biosynthesis of bacteriophage T4 DNA polymerase is autogenously regulated at the translational level. The enzyme, product of gene 43, represses its own translation by binding to its mRNA 5' to the initiator AUG at a 36-40 nucleotide segment that includes the Shine-Dalgarno sequence and a putative RNA hairpin structure consisting of a 5-base-pair stem and an 8-base loop. We constructed mutations that either disrupted the stem or altered specific loop residues of the hairpin and found that many of these mutations, including single-base changes in the loop sequence, diminished binding of purified T4 DNA polymerase to its RNA in vitro (as measured by a gel retardation assay) and derepressed synthesis of the enzyme in vivo (as measured in T4 infections and by recombinant-plasmid-mediated expression). In vitro effects, however, were not always congruent with in vivo effects. For example, stem pairing with a sequence other than wild-type resulted in normal protein binding in vitro but derepression of protein synthesis in vivo. Similarly, a C----A change in the loop had a small effect in vitro and a strong effect in vivo. In contrast, an A----U change near the base of the hairpin that was predicted to increase the length of the base-paired stem had small effects both in vitro and in vivo. The results suggest that interaction of T4 DNA polymerase with its structured RNA operator depends on the spatial arrangement of specific nucleotide residues and is subject to modulation in vivo.     

Structural characterization of d(CAACCCGTTG) and d(CAACGGGTTG) mini-hairpin loops by heteronuclear NMR: the effects of purines versus pyrimidines in DNA hairpins.

The DNA decamers, d(CAACCCGTTG) and d(CAACGGGTTG) were studied in solution by proton and heteronuclear NMR. Under appropriate conditions of pH, temperature, salt concentration and DNA concentration, both decamers form hairpin conformations with similar stabilities [Avizonis and Kearns (1995) Biopolymers, 35, 187-200]. Both decamers adopt mini-hairpin loops, where the first and last four nucleotides are involved in Watson-Crick hydrogen bonding and the central two nucleotides, CC or GG respectively, form the loop. Through the use of proton-proton, proton-phosphorus and natural abundance proton-carbon NMR experiments, backbone torsion angles (beta, gamma and epsilon), sugar puckers and interproton distances were measured. The nucleotides forming the loops of these decamers were found to stack upon one another in an L1 type of loop conformation. Both show gamma tr and unusual beta torsion angles in the loop-closing nucleotide G7, as expected for mini-hairpin loop formation. Our results indicate that the beta and epsilon torsion angles of the fifth and sixth nucleotides that form the loop and the loop-closing nucleotide G7 are not in the standard trans conformation as found in B-DNA. Although the loop structures calculated from NMR-derived constraints are not well defined, the stacking of the bases in the two different hairpins is different. This difference in the base stacking of the loop may provide an explanation as to why the cytosine-containing hairpin is thermodynamically more stable than the guanine-containing hairpin.