Aerobic microbial metabolism of some alkylthiophenes found in petroleum

Six alkylthiophenes, 2-hexadecyl-5-methylthiophene (I), 2-methyl-5-tridecylthiophene (II) and 2-butyl-5-tridecylthiophene (III), 2-(3,7-dimethyloctyl)-5-methylthiophene (IV), 2-methyl-5-(3,7,11,15-tetramethyl-hexadecyl)thiophene (V) and 2-ethyl-5-(3,7,11,15-tetramethylhexadecyl)thiophene (VI) were synthesized and used as substrates in biodegradation studies. The products of their aerobic metabolism by pure bacterial cultures were identified. In most cases, the long alkyl chains of these thiophenes were preferentially attacked and in pure cultures of alkane-degrading bacteria, the major metabolites that accumulated in the medium were 5-methyl-2-thiopheneacetic acid from (I), 5-methyl-2-thiophenecarboxylic acid from (II) and occasionally from (V), 5-butyl-2-thiophenecarboxylic acid from (III) and 5-ethyl-2-thiopheneacetic acid from (VI). These transformations are consistent with the metabolism of the alkyl side chains via the beta-oxidation pathway. In contrast, 5-(3,7-dimethyloctyl)-2-thiophenecarboxylic acid was produced from (IV). Because it was available in greatest supply, (I) was studied most thoroughly. It supported growth of the six n-alkanedegrading bacteria tested and (I) was degraded more quickly than pristance but not as quickly as n-hexadecance in mixtures of these three compounds. In the presence of Prudhoe Bay crude oil and a mixed culture of petroleum-degrading bacteria, the acid metabolites from (I), (II) and (III) underwent further biotransformations to products that were not detected by the analytical methods used. The addition of n-hexadecane to the mixed culture of petroleum-degrading bacteria also enhanced the further biotransformations of the metabolites from (I).     

The chemistry of thiamine: Studies on the dimerization of thiazolium salts

In this communication we report on our studies into the previously undetected dimerization chemistry of thiazolium salts. Thiazolium salts with electron-withdrawing substituents, such as 3,4-dimethyl-5-ethoxycarbonylthiazolium iodide, yield acid- and oxygen-sensitive ethylenic dimers under conditions originally used to detect the dimerization of 3-methylbenzothiazolium iodide. The 5-ethoxycarbonyl-4-methyl-3-phenylmethylthiazolium and 5-(2-O-triphenylmethyl-hydroxyethyl)-4-methyl-3-phenylmethylthiazolium bromides yield stable rearranged dimers, rather than the labile ethylenic dimers, under identical conditions. 4-Methyl-5-(2-hydroxyethyl)-3-phenylmethylthiazolium bromide and thiamine hydrochloride yield rearranged dimers which were isolated as their N,O-ketal derivatives when these salts were heated in aprotic solution in the presence of DBN and K₂CO₃, respectively. Rearrangement of the ethylenic dimer of 3-phenylmethylbenzothiazolium bromide to 2-(benzothiazol-2-yl)-2,3-diphenylmethylbenzothiazoline (J. Baldwin, S. E. Branz, and J. A. Walker (1977) J. Org. Chem. 42, 4142) demonstrates that rearranged dimers of these thiazolium salts are produced via a mechanism involving 1,3-sigmatropic rearrangement of intermediate ethylenic dimers. Based on literature precedent we argue that this dimerization chemistry demonstrates the nucleophilic carbene nature of C-2 deprotonated thiazolium salts in aprotic basic solution.     

Inhibition of the bovine branched-chain 2-oxo acid dehydrogenase complex and its kinase by arylidenepyruvates

A novel class of inhibitors for the branched-chain 2-oxo acid dehydrogenase (BCOAD) complex has been synthesized and studied. The sodium salts of arylidenepyruvates: e.g., furfurylidenepyruvate (compound I), 4-(3-thienyl)-2-oxo-3-butenoate (compound II), cinnamalpyruvate (compound III) and 4-(2-thienyl)-2-oxo-3-butenoate (compound IV) inhibit the overall and kinase reactions of the BCOAD complex from bovine liver. Inhibitions of the overall reaction occur at the decarboxylase (E1) step as determined by a spectrophotometric assay with 2,6-dichlorophenolindophenol as an electron acceptor. Inhibition of the E1 reaction by compound I (Ki = 0.5 microM) is competitive, whereas inhibitions by compounds II (Ki = 150 microM) and III (Ki = 500 microM) are non-competitive with respect to the substrate 2-oxoisovalerate. The Km value for 2-oxoisovalerate is 6.7 microM as measured by the E1 assay. Inhibition of the E1 step by compounds I, II and III are reversible at low inhibitor concentrations based on the Michaelis-Menten kinetics observed. By comparison, compound I does not significantly inhibit pyruvate and 2-oxoglutarate dehydrogenase complexes. The arylidenepyruvates (compounds I, II and IV) inhibit the BCOAD kinase reaction in a manner similar to the substrate 2-oxo acids. The inhibition of the kinase reaction by compound I is non-competitive with respect to ATP, with an apparent Ki value of 4.5 mM. The results suggest that arylidenepyruvates may be useful probes for elucidating the reaction mechanisms of the BCOAD complex and its kinase.     

The action of defoliants on the energetics of rat liver mitochondria in vitro]

The effect of defoliants butyphos (I), dropp (II), butylcaptacs (III), hinazopin (IV), syhat (V), tetra-n-butylammonium bromide (VI), etrel (VII), gemetrel (VIII), allyl-4-methylpyridinium bromide (IX), 1-amino-cyclopropan-1-carbonate (ACPC) (X) at various concentrations (1 x 10(-5)-2 x 10(-4) M) on respiration, oxidative phosphorylation (OP) and permeability of the inner mitochondrial membrane from rat liver has been studied. It has been established that some of the compounds uncouple OP by increasing the inner mitochondrial membrane permeability for H+ (II) inhibit the respiration in V3 condition and induce less selective permeability for a number of ions (I, III). The other defoliants either induce respiration generally in metabolic states 3 and 4 (IV, VI, IX) or have no effect on the respiration and OP (V, VII, VIII, X). On the whole a good correlation between the common toxicity of the studied preparation (LD50) and their mitochondrial effect has been revealed, therefore the latter can be considered as intracellular "targets" involved in the realization of pesticide action.     

The effect of 15-ketosterol analogues with a 5,6-dimethylhept-3-en-2-yl chain at C17 on cholesterol metabolism in Hep G2 hepatoma cells

The effect on cholesterol metabolism in Hep G2 hepatoma cells was studied for new analogues of 15-ketosterol [3beta-hydroxy-5alpha-cholest-8(14)-en-15-one] (I): (24S)-3beta-hydroxy-24-methyl-5alpha-cholesta-8(14),22-diene-15-one (II), (24S)-3alpha-hydroxy-24-methyl-5-alpha-cholesta-8(14),22-diene-15-one (III), and (24S)-24-methyl-5alpha-cholesta-8(14),22-diene-3,15-dione (IV). Analogues (I) and (II) were found to be equally effective inhibitors of cholesterol biosynthesis after a 3-h incubation with Hep G2 cells; however, (II) produced a stronger inhibitory effect after a 24-h incubation or after an incubation of cells preliminarily treated with the inhibitor in a medium containing no ketosterol. The ability of ketosterols to inhibit cholesterol biosynthesis decreased in the order (II) > (IV) > (III). Ketosterol (II) inhibited, whereas ketosterol (III) stimulated the biosynthesis of cholesteryl esters. (IV) stimulated the biosynthesis of cholesteryl esters at a concentration of 1-10 microM and exerted no marked effect at a concentration of 30 microM. These results indicate that delta8(14)-15-ketosterols containing a modified side chain are of interest as regulators of cholesterol metabolism in liver cells. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2004, vol. 30, no. 5; see also http: // www.maik.ru.     

Voltage sensors in domains III and IV, but not I and II, are immobilized by Na+ channel fast inactivation

Using site-directed fluorescent labeling, we examined conformational changes in the S4 segment of each domain of the human skeletal muscle sodium channel (hSkM1). The fluorescence signals from S4 segments in domains I and II follow activation and are unaffected as fast inactivation settles. In contrast, the fluorescence signals from S4 segments in domains III and IV show kinetic components during activation and deactivation that correlate with fast inactivation and charge immobilization. These results indicate that in hSkM1, the S4 segments in domains III and IV are responsible for voltage-sensitive conformational changes linked to fast inactivation and are immobilized by fast inactivation, while the S4 segments in domains I and II are unaffected by fast inactivation.     

3 beta-hydroxyandrost-4-en-6-one derivatives as aromatase inhibitors

The 3-formate (II), 3-acetate (III), 3-bromoacetate (IV), 3-propionate (V), 3-methyl ether (VI), and 3-deoxy-derivative (VII) of 3 beta-hydroxyandrost-4-ene-6,17-dione (I) were synthesized and tested in human placental microsomes for their ability to inhibit aromatase. II, III, and VII of this series were potent inhibitors of aromatase with the IC50's (1.7 and 3.3 microM) of the latter two comparable to that (1.2 microM) of 4-hydroxyandrostenedione. Kinetic studies showed that the three steroids are competitive inhibitors of the enzyme with Ki's of 16.0, 5.5, and 0.61 microM for II, III, and VII. Furthermore, II showed a time-dependent, pseudo-first order rate of inactivation of aromatase with Ki of 20.5 microM and kinact of 1.54 x 10(-2) min-1, while III gave a time-dependent, biphasic loss of the enzyme activity. NADPH and oxygen were required for the time-dependent inactivation and the substrate, androstenedione, prevented it.     

Purification and characterization of isoforms of beta-galactosidases in mung bean seedlings

Five isoforms of beta-galactosidase (EC 3.2.1.23), designated as beta-galactosidases I-V, were isolated from five-day-old mung bean (Vigna radiata) seedlings. Beta-galactosidases II and III were purified to electrophoretic homogeneity by a procedure involving acid precipitation, ammonium sulfate fractionation, chromatography on diethylaminoethyl-cellulose (DEAE-Cellulose) and con A-Sepharose. and chromatofocusing. Beta-galactosidases I, II and III have the same molecular mass of 87 kDa. comprising two nonidentical subunits with molecular masses of 38 and 48 kDa, while beta-galactosidases IV and V have molecular masses of 45 and 73 kDa, respectively. All the enzymes were active against p-nitrophenyl-beta-D-galactoside, and to a lesser extent, p-nitrophenyl-alpha-L-arabinoside and p-nitrophenyl-beta-D-fucoside. The enzymes were inhibited by D-galactono-1,4-lactone, D-galactose, Hg2+, Ag+ and sodium dodecyl sulfate (SDS). Beta-galactosidases I, II and III were shown to be competitively inhibited by either D-galactono-1, 4-lactone or D-galactose. Isoforms I, II and III have a common optimal pH of 3.6, while isoforms IV and V have pH optima at 3.8 and 4.0, respectively. Isoelectric points of isoforms I, II and III were 7.7, 7.5 and 7.3, respectively. Double immunodiffusion analysis indicated that beta-galactosidases I, II, III and V are immunologically similar to each other, while beta-galactosidase IV shares partially identical antigenic determinants with the other four isoforms. The purified beta-galactosidases II and III were capable of releasing D-galactose residue from the hemicellulose fraction isolated from mung bean seeds.     

Ring hydroxylation of di-t-butylhydroxytoluene by rat liver microsomal preparations

3,5-Di-t-butylhydroxytoluene (compound I) was converted into 4-hydroperoxy-4-methyl-2,6-di-t-butylcyclohexa-2,5-dienone (compound II), 4-hydroxy-4-methyl-2,6-di-t-butylcyclohexa-2,5-dienone (compound III) and 2,6-di-t-butyl-4-hydroxymethylphenol (compound IV) by rat liver microsomal preparations in the presence of NADPH and air. The oxidation of compound (I) by m-chloroperbenzoic acid also produced the same compounds. These results suggest that hydroperoxide can be an intermediate in aromatic hydroxylation and that biological oxygenations resemble per-acid reactions.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Steroid derivatives

Mycobacterium flavum was used to effect the transformation of 16β-methyl-16,17-oxido-7β,11α-dihydroxypregn-4-ene-3,20-dione (I) and the final products were isolated and identified as 16β-methyl-16,17-oxido-7β,11α-dihydroxypregna-1,4-diene-3,20-dione (II) and 16β-methyl-16,17-oxido-11α-hydroxypregna-1,4,6-triene-3,20-dione (IV), and the intermediate product as 16β-methyl-16,17-oxido-11α-hydroxypregna-4,6-diene-3,20-dione (III).     

Effects of various radicinin analogs on pulse amplitude and arterial blood pressure

The action of some radicinin analogues on the pulse amplitude in urethane anesthetized rats has been studied. The compounds used are:2,7-dimethyl-4H,5H-pyrano[4,3-b]pyran-4,5-dione (I); 2,3-dihydro-2,7-dimethyl-4H,5H-pyrano[4,3-b]pyran-4,5-dione (II) 7,8-dihydro-2,7-dimethyl-4H,5H-pyrano[4,3-b]pyran-4,5-dione (III) 2,3,7,8-tetrahydro-2,7-dimethyl-4H,5H-pyrano[4,3-b]pyran-4,5-dione(IV); 2,3,7,8,4',8'-hexahydro-2,7-dimethyl-4H,5H-pyrano[4, 3-b]pyran-4,5-dione (V); 3-crotonyl-4-hydroxy-6-methyl-2H-pyran-2-one (VI); 3-hexanoyl-4-hydroxy-6-methyl-2H-pyran-2-one (VII); 3-hexanoyl-5,6-dihydro-4-hydroxy-6-methyl-2H-pyran-2-one (VIII). A clear increase in the pulse has been seen with the compounds (II), (V) and (VII) especially at the lowest doses, while a decrease in the pulse is caused by the compounds (I) and (VIII). The studied substances have no effects on systolic blood pressure in normotensive unanesthetized rats.     

Structure of biologically active and inactive cerebrosides prepared from Schizophyllum commune

A cerebroside fraction prepared from the mycelia of Schizophyllum commune was further fractionated into five components (I-V) by reverse-phase high-performance liquid chromatography. Fruiting-inducing activity was found in I-IV but not in V. By gas-liquid chromatography-mass spectrometry and nuclear magnetic resonance analyses it was shown that these fractions contained: I, a mixture of N-2'-hydroxypentadecanoyl-1-O-glucosyl-nonadecasphingadienine++ + and N-2'-hydroxyhexadecanoyl-1-O-glucosyl-sphingadienine; II, (4E,8E)-N-D-2'-hydroxyhexadecanoyl-1-O-beta-D-glucopyr anosyl-9-methyl-4,8- sphingadienine (Kawai and Ikeda. 1983. Biochim. Biophys. Acta. 754: 243-248); III, N-2'-hydroxyheptadecanoyl-1-O-glucosyl-nonadecasphingadienine++ +; IV, N-2'-hydroxyoctadecanoyl-1-O-glucosyl-nonadecasphinadienine; V, (4E,8E)-N-2'-hydroxytetracosanoyl-1-O-beta-glucopyrano syl-9-methyl-4,8- sphingadienine. The only structural difference observed between biologically active and inactive cerebrosides was the chain length of acyl moiety; the cerebroside having an acyl chain of 24 carbon atoms was inactive.     

Detection of 2-deoxy-D-ribose radicals generated by the reaction with the hydroxyl radical using a rapid flow-ESR method

ESR spectrum of the short-lived radicals derived from 2-deoxy-D-ribose by the reaction with the hydroxyl radical (HO*) was measured using a rapid flow method. A dielectric mixing resonator was used for the measurement, which made it possible to measure the highly sensitive ESR spectra of the radicals with a lifetime of the order of milliseconds. A complex spectrum was obtained and the spectral simulation was done to show that it was the superposition of the signals due to five radicals (I-V). Three of them were those formed by the dehydrogenation with the HO* at C-1 (I), C-3 (II), and C-4 (III) positions of the 2-deoxy-D-ribose molecule. The other two (IV and V) were carbonyl-conjugated radicals formed by the elimination of a water molecule from III and II. The results showed that dehydrogenation occurred randomly at the positions where hydroxyl groups are attached, but the most preferred position was C-3 and the radical position moved from C-3 to C-4 by the elimination of water molecule.     

Evidence that enzyme-generated aromatic Michael acceptors covalently modify the nucleotide-binding site of 3 alpha-hydroxysteroid dehydrogenase.

The non-steroidal allylic and acetylenic alcohols 1-(4'-nitrophenyl)prop-2-en-1-ol (I) and 1-(4'-nitrophenyl)prop-2-yn-1-ol (II) are oxidized by homogeneous 3 alpha-hydroxysteroid dehydrogenase to the corresponding alpha beta-unsaturated ketones 1-(4'-nitrophenyl)prop-2-en-1-one (III) and 1-(4'-nitrophenyl)prop-2-yn-1-one (IV), which then inactivate the enzyme selectively with high affinity; low effective partition ratios are observed for the parent alcohols [Ricigliano & Penning (1989) Biochem. J. 262, 139-149]. Inactivation of 3 alpha-hydroxysteroid dehydrogenase by compound (I) displays an NAD+ concentration optimum. Scavenging experiments indicate that the enzyme-generated inactivators (III) and (IV) alkylate the enzyme via a release-and-return mechanism. Several lines of evidence suggest that compounds (III) and (IV) covalently modify the NAD(P)(+)-binding site. First, micromolar concentrations of NAD(P)H offer substantial protection against enzyme inactivation mediated by Michael acceptors (III) and (IV). In these protection studies Kd measurements for NAD(P)H approached those measured by fluorescence titration of free enzyme. Secondly, under initial-velocity conditions compounds (III) and (IV) act essentially as competitive inhibitors of NAD+ binding, and as mixed competitive or non-competitive inhibitors against androsterone binding. Thirdly, enzyme inactivated with either compound (III) or compound (IV) fails to bind to NAD+ affinity columns (e.g. Affi-gel Blue). Under the same conditions of chromatography native enzyme and enzyme affinity-labelled at the steroid-binding site with 17 beta-bromoacetoxy-5 alpha-dihydrotestosterone is retained on the affinity column. A kinetic scheme that represents the inactivation of the homogeneous dehydrogenase by the enzyme-generated alkylators (III) and (IV) is presented.     

The role of alkyl chain length in the inhibitory effect n-alkyl xanthates on mushroom tyrosinase activities

Sodium salts of four n-alkyl xanthate compounds, C2H5OCS2Na (I), C3H7OCS2Na (II), C4H9OCS2Na (III), and C6H13OCS2Na (IV) were synthesized and examined for inhibition of both cresolase and catecholase activities of mushroom tyrosinase (MT) in 10 mM sodium phosphate buffer, pH 6.8, at 293 K using UV spectrophotometry. 4-[(4-Methylbenzo)azo]-1,2-benzendiol (MeBACat) and 4-[(4-methylphenyl)azo]-phenol (MePAPh) were used as synthetic substrates for the enzyme for catecholase and cresolase reactions, respectively. Lineweaver-Burk plots showed different patterns of mixed, competitive or uncompetitive inhibition for the four xanthates. For the cresolase activity, I and II showed uncompetitive inhibition but III and IV showed competitive inhibition pattern. For the catecholase activity, I and II showed mixed inhibition but III and IV showed competitive inhibition. The synthesized compounds can be classified as potent inhibitors of MT due to their Ki values of 13.8, 11, 8 and 5 microM for the cresolase activity, and 1.4, 5, 13 and 25 microM for the catecholase activity for I, II, III and IV, respectively. For the catecholase activity both substrate and inhibitor can be bound to the enzyme with negative cooperativity between the binding sites (alpha > 1) and this negative cooperativity increases with increasing length of the aliphatic tail of these compounds. The length of the hydrophobic tail of the xanthates has a stronger effect on the Ki values for catecholase inhibition than for cresolase inhibition. Increasing the length of the hydrophobic tail leads to a decrease of the Ki values for cresolase inhibition and an increase of the Ki values for catecholase inhibition.     

Cytotoxic activity of 4'-hydroxychalcone derivatives against Jurkat cells and their effects on mammalian DNA topoisomerase I

Chalcones (1,3-diaryl-2-propen-1-ones) are alpha, beta-unsaturated ketones with cytotoxic and anticancer properties. Several reports have shown that compounds with cytotoxic properties may also interfere with DNA topoisomerase functions. Five derivatives of 4'-hydroxychalcones were examined for cytotoxicity against transformed human T (Jurkat) cells as well as plasmid supercoil relaxation experiments using mammalian DNA topoisomerase I. The compounds were 3-phenyl-1-(4'-hydroxyphenyl)-2-propen-1-one (I), 3-(p-methylphenyl)-1-(4'-hydroxyphenyl)-2-propen-1-one (II), 3-(p-methoxyphenyl)-1-(4'-hydroxyphenyl)-2-propen-1-one (III), 3-(p-chlorophenyl)-1-(4'-hydroxyphenyl)-2-propen-1-one (IV), and 3-(2- thienyl)-1-(4'-hydroxyphenyl)-2-propen-1-one (V). The order of the cytotoxicity of the compounds was; IV > III > II > I > V. Compound IV, had the highest Hammett and log P values (0.23 and 4.21, respectively) and exerted both highest cytotoxicity and strongest DNA topoisomerase I inhibition. Compounds I and II gave moderate interference with the DNA topoisomerase I while III & V did not interfere with the enzyme.     

Characterization of urinary volatiles in Swiss male mice (<Emphasis Type="Italic">Mus musculus</Emphasis>): bioassay of identified compounds

The present study was carried out to investigate the chemical nature of the urine of male mice and to assess its bioactivity. Urine of mature male mice was extracted with dichloromethane (1:1 ratio v/v) and analysed by gas-chromatography linked mass-spectrometry (GC-MS). Ten different compounds such as alkanes, alcohols, etc. were detected in the urine. Among the ten, five compounds are specific to males, namely 3-cyclohexene-1-methanol (I), 3-amino-s-triazole (II), 4-ethyl phenol (III), 3-ethyl-2,7-dimethyl octane (IV) and 1-iodoundecane (V). The compound, 4-ethylphenol, has been previously reported in several strains of male mice. Furthermore, the compounds (II) and (IV) are similar to 2-sec-butylthiazole and dehydro-exo-brevicomin compounds which have already been reported in male mice. Bioassay revealed that compounds (II), (III) and (IV) were responsible for attracting females and in inducing aggression towards males, as compared to the other compounds, i.e. (I) and (V). The results indicate that these three volatiles (II, III and IV) of male mice appear to act as attractants of the opposite sex.     

Isolation and characterization of thermostable chitinases from Bacillus licheniformis X-7u

Four kinds of thermostable chitinase were isolated from the cell-free culture broth of Bacillus licheniformis X-7u by successive column chromatographies on Butyl-Toyopearl, Q-Sepharose, and Sephacryl S-200. We named the enzymes chitinases I(89 kDa), II(76 kDa), III(66 kDa) and IV(59 kDa). Chitinases II, III and IV possessed extremely high optimum temperatures (70-80 degrees C), showing remarkable heat stability. Chitinases II, III and IV produced (GlcNAc)2 and GlcNAc from colloidal chitin and chitinase I predominantly produced (GlcNAc)2. The action pattern of chitinase I on PN-(GlcNAc)4 also showed a stronger propensity to cleave off the (GlcNAc)2 unit from the non-reducing end than the other three chitinases. Chitinases II, III and IV catalyzed a transglycosylation reaction that converted (GlcNAc)4 into (GlcNAc)6.     

Steroidal constituents of Solanum xanthocarpum

From the extract of the fruits of Solanum xanthocarpum, cycloartanol (I), cycloartenol (II), sitosterol (III), stigmasterol (IV), campesterol (V), cholesterol (VI), sitosteryl glucoside (VII), stigmasteryl glucoside (VIII), solamargine (IX), and β-solamargine (X) were identified and an isolated steroid (XI) was identical with 4α-methyl-(24R)-ethylcholest-7-en-3β-ol synthesized from carpesterol.