Perchlorate-induced conformational transition of Staphylococcal nuclease: evidence for an equilibrium unfolding intermediate

The sodium perchlorate-induced conformational transition of Staphylococcal nuclease has been monitored by both circular dichroism (CD) and fluorescence spectroscopy. The perchlorate-induced transition is cooperative as observed by both spectroscopic signals. However, the protein loses only about one-third of its native far-UV CD signal at high perchlorate concentrations, indicating that a significant amount of secondary structure remains in the post-transition state. The remaining CD signal can be further diminished in a cooperative manner by the addition of the strong denaturant, urea. Near-UV CD spectra clearly show that the protein loses its tertiary structure in the perchlorate-induced denatured state. The perchlorate-induced transition curves were fit to the standard two-state model and the standard free energy change and m value of the transition are 2.3kcal/mol and 1.8kcal/(molM), respectively. By comparison, the urea-induced unfolding of Staphylococcal nuclease (in the absence of perchlorate) yields an unfolding free energy change, DeltaG(0,un), of 5.6kcal/mol and an m value of 2.3kcal/(molM). Thus, the thermodynamic state obtained in the post-transition region of perchlorate-induced conformation transition has a significantly lower free energy change, a high content of secondary structure, and diminished tertiary structure. These results suggest that the perchlorate-induced denatured state is a partially folded equilibrium state. Whether this intermediate is relevant to the folding/unfolding path under standard conditions is unknown at this time.     

A method for the experimental study of DNA conformational transitions in fibers

The method proposed for the study of DNA conformational transitions is based on the proportionality, experimentally observed, between the length of a DNA fiber and the axial rise per nucleotide characterizing the molecular helix. Precise curves for the A-B and B-C transitions as a function of the relative humidity are obtained by using X-ray fiber data and measurements of fiber dimensions. It is thus shown that the A-B transition is a cooperative process between two different states, whereas the B-C transition can be considered as a progressive change of conformation. The present method is applied on two natural DNAs differing in base composition so that the effect of the nucleotide content on the conformational changes can be estimated.     

Kinetic mechanism of rat polymerase beta-dsDNA interactions. Fluorescence stopped-flow analysis of the cooperative ligand binding to a two-site one-dimensional lattice

Kinetics of cooperative binding of rat polymerase beta to a double-stranded DNA has been studied using the fluorescence stopped-flow techniques. The data have been analyzed by an approach developed to examine complete kinetics of cooperative large ligand binding to a one-dimensional lattice. The method is based on using the smallest possible system that preserves key ingredients of cooperative binding; i.e., at saturation, the lattice can accept only two ligand molecules. It allows the identification of collective amplitudes as well as amplitudes describing particular normal modes of the reaction. The mechanism of the intrinsic binding of pol beta to the dsDNA is different from the analogous mechanism for the ssDNA. The difference originates from different enzyme orientations in the corresponding complexes. Intrinsic binding to the dsDNA includes only two sequential steps: a very fast bimolecular association followed by an energetically favorable conformational transition of the complex. The transition following the bimolecular step does not facilitate the engagement of the enzyme in cooperative interactions. Its role seems to be reinforcing the affinity of the bimolecular step. Salt and magnesium cations affect both the bimolecular step and the conformational transition. As a result, the bimolecular step is less sensitive to the increased salt concentration, allowing the enzyme to preserve its initial dsDNA affinity. The changing character of cooperative interactions between bound enzyme molecules as a function of NaCl concentration and MgCl(2) concentration does not affect the binding mechanism. The engagement in cooperative interactions is approximately 3-4 orders of magnitude slower than the conformational transition of the DNA-bound polymerase. The importance of the obtained results for the pol beta activities is discussed.     

Partially unfolded equilibrium state of hen lysozyme studied by circular dichroism spectroscopy

Equilibrium unfolding of hen egg white lysozyme as a function of GdnCl concentration at pH 0.9 was studied over a temperature range 268.2-303.2 K by means of CD spectroscopy. As monitored by far- and near-UV CD at 222 and 289 nm, the lack of coincidence between two unfolding transition curves was observed, which suggests the existence of a third conformational species in addition to native and unfolded states. The three-state model, in which a stable intermediate is populated, was employed to estimate the thermodynamic parameters for the GdnCl-induced unfolding. It was found that the transition from the native to intermediate states proceeds with significant changes in enthalpy and entropy due to an extremely cooperative process, while the transition from the intermediate to unfolded states shows a low cooperativity with small enthalpy and entropy changes. These results indicate that the highest energy barrier for the GdnCl-induced unfolding of hen lysozyme is located in the process from the native state to the intermediate state, and this process is largely responsible for the cooperativity of protein unfolding.     

Functional visualization of viral molecular motor by hydrogen-deuterium exchange reveals transient states

Molecular motors undergo cyclical conformational changes and convert chemical energy into mechanical work. The conformational dynamics of a viral packaging motor, the hexameric helicase P4 of dsRNA bacteriophage phi8, was visualized by hydrogen-deuterium exchange and high-resolution mass spectrometry. Concerted changes of exchange kinetics revealed a cooperative unit that dynamically links ATP-binding sites and the central RNA-binding channel. The cooperative unit is compatible with a structure-based model in which translocation is mediated by a swiveling helix. Deuterium labeling also revealed the transition state associated with RNA loading, which proceeds via opening of the hexameric ring. The loading mechanism is similar to that of other hexameric helicases. Hydrogen-deuterium exchange provides an important link between time-resolved spectroscopic observations and high-resolution structural snapshots of molecular machines.     

Calorimetric study of the order-disorder conformational transition in succinoglycan

Thermally induced order-disorder conformational transition in succinoglycan was studied using the method of high-sensitivity differential scanning microcalorimetry within the range of polysaccharide concentrations from 0.1 to 3.5 mg mL⁻¹ at NaCl concentrations 0, 0.01, and 0.1M. The positions and shapes of the excess heat capacity curves depended substantially on both the NaCl and polysaccharide concentrations. At low polysaccharide concentrations in salt-free solution the experimental curves were closely approximated by the two-state model suggesting the transition mechanism to be of the single helix-coil type. With increasing polysaccharide and/or NaCl concentration, the experimental curves changed significantly in symmetry, which indicated a changing transition mechanism. At high polysaccharide concentrations or in the presence of the salt, the order-disorder transition of succinoglycan was shown to include two stages: the cooperative dissociation of the helix dimer and subsequent two-state melting of the helix monomer. The dependence of thermodynamic parameters for the dissociation and melting of helix structures in succinoglycan on NaCl and polysaccharide concentrations was obtained by fitting the experimental excess heat capacity curves. The cooperativity parameter σ for the single helix-coil transition as well as the average length of the helix segment of succinoglycan were calculated. Some features of succinoglycan ordering in solution are discussed. © 1996 John Wiley & Sons, Inc.     

Conformational transition of parallel DNA in solutions with decreased water activity]

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.     

Biphasic helix–coil transition of the ethidium bromide·poly(dA-dT) and the propidium diiodide·poly(dA-dT) Complexes. Stabilization of base-pair regions centered about the intercalation site

The nonexchangeable base and sugar proton nmr resonances and the 260 and 278-nm uv-absorbance bands of the nucleic acid were utilized to monitor the temperature-dependent duplex-to-strand transition of the alternating purine–pyrimidine deoxyribopolynucleotide poly(dA-dT) in the absence and presence of ethidium bromide (EB) at phosphate/drug = 50, 28, and 15 and propidium diiodide (PI) at P/D = 50, 25, 15, 10, and 5 in 0.1 M salt between 50° and 100°C. The nmr and optical methods monitor a biphasic duplex-to strand transition for the drug–poly(dA-dT) complexes. We have monitored the dissociation of the drug from the complex at the ethidium bromide phenanthridine ring and side-chain proton nmr resonances and the propidium diiodide 494 and 535-nm uv-absorbance bands and demonstrate that dissociation of the drug corresponds to the higher temperature transition in the biphasic nucleic acid melting curves. The lower temperature cooperative transition is assigned to the opening of drug-free AT base-pair regions in the drug–poly(dA-dT) complex and exhibits an increase in transition midpoint and a decrease in cooperativity with increasing drug concentration. The higher temperature cooperative transition is assigned to the opening of AT base-pair regions centered about the bound drug in the complex and exhibits an increase in the transition midpoint on raising the drug concentration. The large upfield shifts of the phenanthridine ring (but not side chain) protons of ethidium bromide on complex formation demonstrate intercalation of the drug between base pairs of the poly(dA-dT) duplex. The nucleic acid base and sugar resonances of poly(dA-dT) in 0.1 M phosphate undergo chemical shift changes between 0° and 50°C indicative of premelting conformational transition(s).     

Conformational transition of poly(alpha-L-glutamic acid). A polyelectrolytic approach

The charge-induced conformational transition of poly(alpha-L-glutamic acid) (PLGA) is considered in this paper from the point of view of proton dissociation. Equations for the excess electrostatic Gibbs energy of dissociation (i.e., delta pKa) are derived as a function of the degree of ionization, alpha. These analytical equations are used to describe some experimental dissociation curves at different polymer and salt concentrations. The dependence of the calculated delta pKa with respect to the ionic strength for the two conformational states, alpha-helical and extended coil, respectively, is rather satisfactorily explained. Even more interesting are the predictions which are derived from this approach for the transition point, alpha tr which is found to be ionic-strength dependent, in full agreement with the experimental results.     

Intramolecular alpha-helix-beta-structure-random coil transition in polypeptides. I. Equilibrium case

The present paper is devoted to the study of the conformational transition of polypeptides which are capable of forming alpha-helix, beta-structure and random coil conformations with the finite homogeneous chain model. The experimental results on the surfactant-induced conformational change of poly(L-lysine) can be well described by the present model assuming cooperative binding of the surfactant ions to the polypeptide side groups.     

Concentration-dependent effects of anions on the anaerobic oxidation of hemoglobin and myoglobin

The redox potentials of hemoglobin and myoglobin and the shapes of their anaerobic oxidation curves are sensitive indicators of globin alterations surrounding the active site. This report documents concentration-dependent effects of anions on the ease of anaerobic oxidation of representative hemoglobins and myoglobins. Hemoglobin (Hb) oxidation curves reflect the cooperative transition from the T state of deoxyHb to the more readily oxidized R-like conformation of metHb. Shifts in the oxidation curves for Hb A(0) as Cl(-) concentrations are increased to 0.2 m at pH 7.1 indicate preferential anion binding to the T state and destabilization of the R-like state of metHb, leading to reduced cooperativity in the oxidation process. A dramatic reversal of trend occurs above 0.2 m Cl(-) as anions bind to lower affinity sites and shift the conformational equilibrium toward the R state. This pattern has been observed for various hemoglobins with a variety of small anions. Steric rather than electronic effects are invoked to explain the fact that no comparable reversal of oxygen affinity is observed under identical conditions. Evidence is presented to show that increases in hydrophilicity in the distal heme pocket can decrease oxygen affinity via steric hindrance effects while increasing the ease of anaerobic oxidation.     

Role of substrate binding forces in exchange-only transport systems: I. Transition-state theory

Summary An analysis of transition-state models for exchange-only transport shows that substrate binding forces, carrier conformational changes, and coupled substrate flow are interrelated. For a system to catalyze exchange but not net transport, addition of the substrate must convert the carrier from an immobile to a mobile form. The reduction in the energy barrier to movement is necessarily paid for out of the intrinsic binding energy between the substrate and the transport site, and is dependent on the formation of two different types of complex: a loose complex initially and a tight complex in the transition state in carrier movement. Hence the site should at first be incompletely organized for optimal binding but, following a conformational change, complementary to the substrate structure in the transition state. The conformational change, which may involve the whole protein, would be induced by cooperative interactions between the substrate and several groups within the site, involving a chelate effect. The tightness of coupling, i.e., the ratio of exchange to net transport, is directly proportional to the increased binding energy in the transition state, a relationship which allows the virtual substrate dissociation constant in the transition state to be calculated from experimental rate and half-saturation constants. Because the transition state is present in minute amount, strong bonding here does not enhance the substrate's affinity, and specificity may, therefore, be expressed in maximum exchange rates alone. However, where substrates largely convert the carrier to a transport intermediate whose mobility is the same with all substrates, specificity is also expressed in affinity. Hence the expression of substrate specificity provides evidence on the translocation mechanism.     

Zipping and Unzipping of Adenylate Kinase: Atomistic Insights into the Ensemble of Open ↔ Closed Transitions

Adenylate kinase (AdK), a phosphotransferase enzyme, plays an important role in cellular energy homeostasis. It undergoes a large conformational change between an open and a closed state, even in the absence of substrate. We investigate the apo-AdK transition at the atomic level both with free-energy calculations and with our new dynamic importance sampling (DIMS) molecular dynamics method. DIMS is shown to sample biologically relevant conformations as verified by comparing an ensemble of hundreds of DIMS transitions to AdK crystal structure intermediates. The simulations reveal in atomic detail how hinge regions partially and intermittently unfold during the transition. Conserved salt bridges are seen to have important structural and dynamic roles; in particular, four ionic bonds that open in a sequential, zipper-like fashion and, thus, dominate the free-energy landscape of the transition are identified. Transitions between the closed and open conformations only have to overcome moderate free-energy barriers. Unexpectedly, the closed state and the open state encompass broad free-energy basins that contain conformations differing in domain hinge motions by up to 40°. The significance of these extended states is discussed in relation to recent experimental Förster resonance energy transfer measurements. Taken together, these results demonstrate how a small number of cooperative key interactions can shape the overall dynamics of an enzyme and suggest an “all-or-nothing” mechanism for the opening and closing of AdK. Our efficient DIMS molecular dynamics computer simulation approach can provide a detailed picture of a functionally important macromolecular transition and thus help to interpret and suggest experiments to probe the conformational landscape of dynamic proteins such as AdK.     

Interlevel relations in neural memory: extrasynaptic reception of mediators, potentiation, and spontaneous activity

The firing of "spontaneous" spikes is regarded as a result of mediator propagation to extrasynaptic receptors. Receptor-receptor interaction unites them in dimer and dimer clusters, which accept three conformational states under agonist action. There are two cooperative and potential dependent transitions between the states, where cluster accumulates or releases energy. The released energy can trigger a mechanism of endogenous (spontaneous) neuron firing in potentiation condition. These accumulating and triggering properties are absent in third (passive) conformational state, where gating charges immobilization reduces conformational mobility. The features of ionotropic, metabotropic and combined mediator action are discussed for different level of slow potential. Conformational effect depends on conformity of pattern space-temporal structure to geometric and functional features of metabotropic mediator sources in cluster environment. Each cluster appears to be adjusted for recognizing a certain vast set of afferent patterns. Number, structure and dimensionality of the recognized patterns are given by: 1) threshold of conformational transition, 2) allocation of synaptic and extrasynaptic mediator ejecting points in gap-hole environment of the receptive cluster 3) combinatorial connections of presynaptic cells with inhibit and excite synapses and 4) signal delays in presynaptic ways and neuropil. Numerous receptive clusters of soma-dendrite membrane are capable to write down information, to keep and accumulate it and to recover. Engram stored as passive/active conformational receptive cluster states is recovered in inversion by "spontaneous" neuronal activity. The original information may be recovered by reading via inhibit synapses.     

Stress sensor triggers conformational response of the integral membrane protein microsomal glutathione transferase 1

Microsomal glutathione (GSH) transferase 1 (MGST1) is a trimeric, integral membrane protein involved in cellular response to chemical or oxidative stress. The cytosolic domain of MGST1 harbors the GSH binding site and a cysteine residue (C49) that acts as a sensor of oxidative and chemical stress. Spatially resolved changes in the kinetics of backbone amide H/D exchange reveal that the binding of a single molecule of GSH/trimer induces a cooperative conformational transition involving movements of the transmembrane helices and a reordering of the cytosolic domain. Alkylation of the stress sensor preorganizes the helices and facilitates the cooperative transition resulting in catalytic activation.     

Cooperative equilibrium transitions coupled with a slow annealing step explain the sharpness and hysteresis of collagen folding.

Heat and guanidinium-induced denaturation curves of collagen III and its fragments were fitted by theoretical models to explain the extreme sharpness and the hysteresis between unfolding and refolding. It was shown that a recently proposed kinetic model for collagen denaturation does not account for the observed steepness, with physically reasonable values of activation energy and frequency factors in the Arrhenius equation. The extreme slope, which amounts to 0.38 per centigrade for collagen III at the midpoint of its transition, can only be explained by a highly cooperative equilibrium model. The refolding curve is shifted to lower temperatures by 6 degrees C for collagen III and reversible unfolding matching the initial profile of the native protein is observed only after long-time annealing. A simple formalism is proposed by which experimental denaturation and refolding curves are quantitatively described. The transition proceeds via many cooperative steps with slightly different equilibrium constants for unfolding and refolding. Hysteresis and annealing are caused by very slow steps, which are probably connected with a rearrangement of misfolded regions. These slow steps disappear with decreasing size of collagen fragments and hysteresis is not found for collagen model peptides.     

Exploring the role of large conformational changes in the fidelity of DNA polymerase beta

The relationships between the conformational landscape, nucleotide insertion catalysis and fidelity of DNA polymerase beta are explored by means of computational simulations. The simulations indicate that the transition states for incorporation of right (R) and wrong (W) nucleotides reside in substantially different protein conformations. The protein conformational changes that reproduce the experimentally observed fidelity are significantly larger than the small rearrangements that usually accompany motions from the reactant state to the transition state in common enzymatic reactions. Once substrate binding has occurred, different constraints imposed on the transition states for insertion of R and W nucleotides render it highly unlikely that both transition states can occur in the same closed structure, because the predicted fidelity would then be many orders of magnitude too large. Since the conformational changes reduce the transition state energy of W incorporation drastically they decrease fidelity rather than increase it. Overall, a better agreement with experimental data is attained when the R is incorporated through a transition state in a closed conformation and W is incorporated through a transition state in one or perhaps several partially open conformations. The generation of free energy surfaces for R and W also allow us to analyze proposals about the relationship between induced fit and fidelity.     

Multiple-step kinetic mechanism of DNA-independent ATP binding and hydrolysis by Escherichia coli replicative helicase DnaB protein: quantitative analysis using the rapid quench-flow method

The kinetic mechanism of DNA-independent binding and hydrolysis of ATP by the E. coli replicative helicase DnaB protein has been quantitatively examined using the rapid quench-flow technique. Single-turnover studies of ATP hydrolysis, in a non-interacting active site of the helicase, indicate that bimolecular association of ATP with the site is followed by the reversible hydrolysis of nucleotide triphosphate and subsequent conformational transition of the enzyme-product complex. The simplest mechanism, which describes the data, is a three-step sequential process defined by:?eqalign???rm Helicase+ATP?&?mathop??rightleftharpoons? ?k_1?_?k_?-1????rm (H-ATP)??mathop??rightleftharpoons? ?k_2?_?k_?-2????rm (H-ADP?cdot Pi)??cr &?mathop??rightleftharpoons? ?k_3?_?k_?-3????rm (H-ADP?cdot Pi)? *?The sequential character of the mechanism excludes conformational transitions of the DnaB helicase prior to ATP binding. Analysis of relaxation times and amplitudes of the reaction allowed us to estimate all rate and equilibrium constants of partial steps of the proposed mechanism. The intrinsic binding constant for the formation of the (H-ATP) complex is K(ATP)=(1.3+/-0.5)x10(5) M(-1). The analysis of the data indicates that a part of the ATP binding energy originates from induced structural changes of the DnaB protein-ATP complex prior to ATP hydrolysis. The equilibrium constant of the chemical interconversion is K(H)=k(2)/k(-2) approximately 2 while the subsequent conformational transition is characterized by K(3)=k(3)/k(-3) approximately 30. The low value of K(H) and the presence of the subsequent energetically favorable conformational step(s) strongly suggest that free energy is released from the enzyme-product complex in the conformational transitions following the chemical step and before the product release.The combined application of single and multiple-turnover approaches show that all six nucleotide-binding sites of the DnaB hexamer are active ATPase sites. Binding of ATP to the DnaB hexamer is characterized by the negative cooperativity parameter sigma=0.25(+/-0.1). The negative cooperative interactions predominantly affect the ground state of the enzyme-ATP complex. The significance of these results for the mechanism of the free energy transduction of the DnaB helicase is discussed.     

Cooperative transition in the conformation of 24-mer tarantula hemocyanin upon oxygen binding

Hemocyanins are large respiratory proteins of arthropods and mollusks, which bind oxygen with very high cooperativity. Here, we investigated the relationship between oxygen binding and structural changes of the 24-mer tarantula hemocyanin. Oxygen binding of the hemocyanin was detected following the fluorescence intensity of the intrinsic tryptophans. Under the same conditions, structural changes were monitored by the non-covalently bound fluorescence probe Prodan (6-propionyl-2-(dimethylamino)-naphthalene), which is very sensitive to its surroundings. Upon oxygen binding of the hemocyanin a red shift of 5 nm in the emission maximum of the label was observed. A comparison of oxygen binding curves recorded with tryptophan and Prodan emission revealed that structural changes in tarantula hemocyanin lag behind oxygen binding at the beginning of oxygenation. Analyses based on the nested two-state model, which describes cooperative oxygen binding of hemocyanins, indicated that the transition monitored by Prodan emission is closely related to one of the four conformations (rR) predicted for the allosteric unit. Earlier, the allosteric unit of tarantula hemocyanin was found to be the 12-mer half-molecule. Here, fluorescence titration revealed that the number of Prodan binding sites/24-mer tarantula hemocyanin is approximately 2, matching the number of allosteric units/hemocyanin. Based on the agreement between oxygen binding curves and fluorescence titration we concluded that Prodan monitors a conformational transition of the allosteric unit.     

Kinetics of the subtransition of asymmetrically substituted phosphatidylcholines

The thermodynamics and kinetics of the subtransition L epsilon----P beta of sonicated unilamellar vesicles of 1-myristoyl-2-stearoylphosphatidylcholine (1M-2S-PC) and of 1-stearoyl-2-myristoylphosphatidylcholine (1S-2M-PC) were studied by equilibrium cooling curves and temperature-jump relaxation spectrometry with an anthracenophane cryptand as a mobile fluorescent probe. The unilamellar vesicles exhibit the midpoint temperature TsII of the subtransition about 10 degrees C below the respective main transition. The kinetics of the subtransition in the time range between 10(-4) and 10(3) s is characterized by a cooperative relaxation process in the range of milliseconds and a further noncooperative process in the range of seconds. The slow process is assigned to the rearrangement of lattice defects. The fast process is evaluated in terms of a cyclic reaction scheme that consists of two pathways for the biomolecular association of probe and vesicle coupled with the conformational change of the lipid matrix during the subtransition. The analysis reveals that the fast process comprises the nucleation and growth of cluster. The cooperative lattice transformation of the subtransition follows a first-order rate law. The rate constants at TsII are 70 s-1 for 1S-2M-PC and 170 s-1 for 1M-2S-PC. Since the plots of the relaxation time vs. the degree of transition are in accordance with the predictions of the linear Ising model, it is concluded that clusters are propagated anisotropically in a linear fashion; e.g., fluidlike P beta conformations grow along the ripple.