Homologous interactions of λ repressor and λ Cro with the λ operator

Lambda repressor and lambda Cro bind to the same six sites on the phage chromosome but with different relative affinities. Nucleotides at certain positions in the operator are conserved in all sites, as are amino acids at certain positions in the recognition α-helices of repressor and Cro. Here we focus on one of the conserved amino acids, a serine found at position 2 of each recognition helix. We show that, contrary to a previous model, both serines contact the same conserved position in the operator, position 4. We suggest a simplified view of how repressor and Cro recognize similar operator sites but distinguish differently among them.     

1H NMR study of the interaction of bacteriophage λ Cro protein with the O R 3 operator

The 17 base pair operator O _R ³ oligonucleotide, which is the preferential binding site for the Cro repressor of phage , was studied by two-dimensional NMR spectroscopy. A sequential assignment procedure based on two-dimensional Nuclear Overhauser Effect (NOESY) and scalar coupling correlated (COSY) NMR spectroscopy, together with the knowledge of the oligodesoxynucleotide sequence, made it possible to assign the non-exhangeable base protons and the H1 and the H2-H2 sugar protons of the O _R ³ operator DNA. The pattern of the observed NOE connectivities is consistent with a right-handed helical DNA structure. The base and sugar proton assignments provide the necessary information for further studies of the O _R ³ operator — Cro repressor interaction.Abbreviations COSY correlated spectroscopy - FID free induction decay - NOE nuclear Overhauser effect - NOESY nuclear Overhauser effect spectroscopy - RD relaxation delay - TSP sodium 3-trimethylsilyl-(2,2,3,3-²H₄)propionate - EDTA sodium ethylendiamine tetraacetate     

Interaction of λ Cro repressor and its V55C mutant S-S dimer with symmetrical and asymmetrical DNA

Interaction of phage λ repressor Cro and its mutant form CroV55C, an S-S-bonded dimer that arises spontaneously as a result of substitution of Val55 with Cys, with synthetic oligonucleotide duplexes was studied using competition with the antibiotic distamycin A. The equilibrium binding constants of Cro with phage λ operator O_R3 and various oduplexes containing right and left O_R3 half-operators with single-basepair deletions and insertions in the center of duplexes were calculated. The highest binding constant was obtained when Cro was adsorbed on the symmetrical 17-bp complex O_S, composed of two left half-operators. Deletion of the central GC pair or insertion of an additional GC in O_S decreased the binding constant by a factor of 4–5. The Cro binding constant for the symmetrical 17-bp duplex O_D consisting of two right half-operators and its analog with an additional central GC was five times lower than that for O_S. The thermodynamic binding characteristics of some oligonucleotide duplexes with CroV55C were determined. The binding constant for CroV55C with O_R3 was lower by an order of magnitude than that of Cro, whereas with O_D the CroV55C and Cro binding constants were much the same. For CroV55C and a symmetrical analog of O_S with the central GC deleted, the binding constant increased by an order of magnitude over that for CroV55C and O_R3.     

Effects on protein structure and function of replacing tryptophan with 5-hydroxytryptophan: Single-tryptophan mutants of the N-terminal domain of the bacteriophage λ repressor

Conformational energy computations have been carried out on the N-acetyl-N′-methylamide of 5-hydroxytryptophan (5OH-Trp) using ECEPP/3. As observed with tryptophan (Trp), the most preferred conformation about theC ^α ?C ^β bond of the side chain isg ⁺ ort. This preference is reduced to only thet conformational state when 5-hydroxyTrp is in the middle of a right-handed poly(l-alanine)α-helix. A similar result has been obtained with Trp [Pielaet al. (1987),Biopolymers 1987, 1273–1286]. These results suggest that replacement of Trp by its analog 5-hydroxyTrp may be tolerated in anα-helix. To test this hypothesis, we have replaced Trp by 5OH-Trp in the fifth helices of two functionally active mutants of the N-terminal domain of the bacteriophage λ repressor. Computations on the packing of these helices have shown that no significant structural changes result from the replacement of Trp by 5OH-Trp. The DNA-binding activity of these mutants, as assessed indirectly through geometrical parameters, is also unaltered.     

OR3 operator of bacteriophage λ in a 23 base-pair DNA fragment: Sequence-specific 1H NMR assignments for the non-labile protons and comparison with the isolated 17 base-pair operator

Sequence-specific ¹H NMR assignments are presented for a non-selfcomplementary 23-base-pair DNA duplex of molecular weight 15,000 daltons, containing the O_R3 repressor binding site of bacteriophage as the central core. The NMR techniques used were mainly phase-sensitive two-dimensional NOE and 2Q spectroscopy, the latter to overcome overlap problems within the spectral region of the deoxyribose spin-systems. Direct sequential NOE connectivities are observed between adenine 2H and deoxyribose 1 protons. We propose the use of these connectivities as a check of the assignments of C1 and A2 protons, which have independently been derived via other assignment pathways.Abbreviation COSY 2-dimensional correlated spectroscopy - NOESY 2-dimensional nuclear-Overhauser-enhancement spectroscopy - RELAYED-COSY 2-dimensional relayed coherence transfer spectroscopy - 2Q two-quantum - ppm parts per million - 23-bp DNA d-(ATCTATCACCGCAAGGGATAAAT) · d-(ATTTATCCCTTGCGGTGATAGAT) - 17-bp DNA (O_R3) d-(TATCACCGCAAGGGATA) · d-(TATCCCTTGCGGTGATA) - d_i(X;Y) intra-residue distance between protons X and Y - d_s(X;Y) sequential distance between protons X and Y located in sequentially neighbouring nucleotides, where the direction from X to Y is always from 5 to 3     

ClpP/ClpX-mediated degradation of the bacteriophage λ O protein and regulation of λ phage and λ plasmid replication

The O protein is a replication initiator that binds to the orilambda region and promotes assembly of the bacteriophage lambda replication complex. This protein, although protected from proteases by other elements of the replication complex, in a free form is rapidly degraded in the host, Escherichia coli, by the ClpP/ClpX protease. Nevertheless, the physiological role of this rapid degradation remains unclear. Here we demonstrate that the copy number of plasmids derived from bacteriophage lambda is significantly higher in wild-type cells growing in rich media than in slowly growing bacteria. However, lambda plasmid copy number in bacteria devoid of the ClpP/ClpX protease was not dependent on the bacterial growth rate and in all minimal media tested was comparable to that observed in wildtype cells growing in a rich medium. Contrary to lambda plasmid replication, the efficiency of lytic growth of bacteriophage lambda was found to be dependent on the host growth rate in both wild-type bacteria and clpP and clpX mutants. The activities of two major lambda promoters operating during the lytic development, p(R) and p(L), were found to be slightly dependent on the host growth rate. However, when p(R) activity was significantly decreased in the dnaA mutant, production of phage progeny was completely abolished at low growth rates. These results indicate that the O protein (whose level in E. coli cells depends on the activity of ClpP/ClpX protease) is a major limiting factor in the regulation of lambda plasmid replication at low bacterial growth rates. However, this protein seems to be only one of the limiting factors in the bacteriophage lambda lytic development under poor growth conditions of host cells. Therefore, it seems that the role of the rapid ClpP/ClpX-mediated proteolysis of the O protein is to decrease the efficiency of early DNA replication of the phage in slowly growing host cells.     

Spectral study of the interaction of DNA with benzothiazolyl-benz-α-chromene

Absorption and luminescence excitation and emission spectra of newly synthesized 2-(4-methylphenylimino)-3-(2 -benzothiazolyl)benz-alpha-chromene (BCBT) have been studied in the presence of various DNA concentrations. BCBT is characterized by the existence of two different fluorescent systems, exhibiting radiationless fluorescence resonance energy transfer between them. In the range of molar ratios of polynucleotide/dye concentrations from 0 to 50, BCBT preferentially intercalates into DNA due to its benz-alpha-chromene fragment, whereas the 2-benzothiazolyl fragment is responsible for fluorescence.     

Computer simulation of the interaction of α3hclix of λ Cro protein with DNA and origin of sequence specific recognition

The conformation of the α3 helix of Cro protein (residues 27–36) of bacteriophageλ is optimised by the damped least square minimization technique, with the steric constraint that Cα atom positions should match the crystallographic data available to date. On the basis of minimization of total interaction and conformation energy, models for complexes of this peptide sequence with heptanucleotide duplexes from native and altered O_R3 operator are obtained in the major groove of B DNA. Analysis of the energetics for 3 sequences of the DNA show that binding strength is derived mainly from the interaction of side chains of the peptide with DNA. Sequence specificity (maximum difference in binding energy for different DNA sequences) is due to hydrogen bonding interaction. A small amount of sequence specificity is derived from non-bonded interaction also. Stereochemical aspects of peptide DNA interaction and their role in DNA recognition are discussed in this paper.     

Joining of λ bacteriophage DNA moleculesin vitro using the gene product of the λint phage

The ability of cell extracts ofEscherichia coli 1100 prepared at different times after infection with bacteriophage λint 6 cI 857 or λ 857 to attach molecules of λ³²P-DNA to λ DNA adsorbed on a nitrocellulose membrane filter was compared. It was found that only with extracts from cells infected with bacteriophage λ cI 857 with an active int gene was it possible to attach molecules of λ³²P-DNA to λ DNA. This ability was reflected best in extracts prepared from cells 10 min after infection. A similar ability was observed also with extracts prepared from cells ofEscherichia coli 1100 (λ cI 857) after heat induction of the prophage. The maximum efficiency in this case was observed with cell extracts 15 min after the temperature rise.     

A Mössbauer study of the interaction of chitosan and D-glucosamine with iron and its relevance to other metalloenzymes

The interaction of iron with water-soluble polymer chitosan and monomer d-glucosamine is investigated by M?ssbauer spectroscopy. The 4.2 K M?ssbauer spectrum of Fe-water-soluble chitosan complex indicates the presence of a magnetic pattern and a quadrupole doublet, and analysis of the spectral data leads to the conclusion that an Fe(II) state is partially stabilized in this system. Fe-glucosamine (monomer of chitosan) complex, on the other hand, clearly stabilizes the Fe(II) state in the acidic pH range as evidenced from the isomer shift extracted from the M?ssbauer spectra. The oxidation state of the metal ion in the complex is found to be pH dependent. Indirect evidence supporting the involvement of amino group in the bonding with the metal ion is discussed. From the analysis of the experimental data under varying experimental conditions, it is concluded that the metal ion in the complex is at least tetracoordinated and at most hexacoordinated with O/N ligands of the polymer or monomer and thus corroborates the bonding scheme proposed earlier.     

Stationary phase-like properties of the bacteriophage λ Rex exclusion phenotype

The rex genes of bacteriophage lambda were found to protect lysogenic Escherichia coliK host cells against killing by phage T4 rII, when compared in parallel to isogenic Rex(-) lysogens and nonlysogens. This protective effect was abrogated upon mutation of the host stationary-phase sigma factor RpoS. Rex(+) lysogens infected by T4 rII contracted, formed aggregates and shed flagella, thus resembling cells entering stationary phase. These phenotypes were accentuated in nonlysogenic cells carrying multicopy plasmids expressing rexA-rexB: cells were about two-fold contracted in length, expressed membrane-bound and detached flagella, were insensitive to infection by a variety of phages and clumped extensively; in addition, cultures of these cells were odorous. Our observations support the hypothesis that the Rex system can cause a stationary-phase-like response that protects the host against infection by T4 rII.     

Advances in the study of protein–DNA interaction

Protein-DNA interaction plays an important role in many biological processes. The classical methods and the novel technologies advanced have been developed for the interaction of protein-DNA. Recent developments of these methods and research achievements have been reviewed in this paper.     

Assembly of bacteriophage lambda heads: Protein processing and its genetic control in petit λ assembly

Petit bacteriophage λ is a hollow λ head precursor which is found in λ-infected lysates, including lysates of phage λ carrying mutations in head genes. Wild-type petit λ has a protein composition similar to heads, except that it is missing pD ⁴, a major component of heads. About 95% of the mass of petit λ is pE, the major structural protein of heads, and in addition it has proteins pB, h3, X1, and X2. Tryptic fingerprint analysis shows that h3 is a proteolytic cleavage product of pB, and previous experiments have shown that X1 and X2 are protein fusion products, closely related to each other and containing amino acid sequences of both pC and pE. Petit lambdas derived from infection by phages defective in genes A or D are indistinguishable from wild-type petit λ. B⁻, C⁻, or groE⁻ defective petit lambdas show differences from wild-type in protein composition and in extent of protein processing. On the basis of the properties of mutant petit lambdas it is concluded that: (1) the protein processing reactions (cleavage of pB; fusion of pC with pE) occur on the petit λ structure; (2) cleavage of pB requires the functioning of genes C and groE but not A or D; (3) fusion of pC and pE requires gene groE but not A, B or D; (4) pNu3 participates directly in petit λ assembly but is lost from the structure by the time assembly is complete.Physical studies of petit λ show that wild-type, A⁻, B⁻ and D⁻ petit lambdas sediment at 150 S, while C⁻ and groE⁻ petit lambdas sediment at 190 S. Purified petit λ of either class has an ultraviolet absorption spectrum characteristic of pure protein.     

Structural bases of dimerization of yeast telomere protein Cdc13 and its interaction with the catalytic subunit of DNA polymerase α

Budding yeast Cdc13-Stn1-Ten1 (CST) complex plays an essential role in telomere protection and maintenance, and has been proposed to be a telomere-specific replication protein A (RPA)-like complex. Previous genetic and structural studies revealed a close resemblance between Stn1-Ten1 and RPA32-RPA14. However, the relationship between Cdc13 and RPA70, the largest subunit of RPA, has remained unclear. Here, we report the crystal structure of the N-terminal OB (oligonucleotide/oligosaccharide binding) fold of Cdc13. Although Cdc13 has an RPA70-like domain organization, the structures of Cdc13 OB folds are significantly different from their counterparts in RPA70, suggesting that they have distinct evolutionary origins. Furthermore, our structural and biochemical analyses revealed unexpected dimerization by the N-terminal OB fold and showed that homodimerization is probably a conserved feature of all Cdc13 proteins. We also uncovered the structural basis of the interaction between the Cdc13 N-terminal OB fold and the catalytic subunit of DNA polymerase α (Pol1), and demonstrated a role for Cdc13 dimerization in Pol1 binding. Analysis of the phenotypes of mutants defective in Cdc13 dimerization and Cdc13-Pol1 interaction revealed multiple mechanisms by which dimerization regulates telomere lengths in vivo. Collectively, our findings provide novel insights into the mechanisms and evolution of Cdc13.