共查询到20条相似文献,搜索用时 0 毫秒
1.
NMR studies on the binding of antitumor drug nogalamycin to DNA hexamer d(CGTACG). 总被引:2,自引:0,他引:2
下载免费PDF全文

H Robinson Y C Liaw G A van der Marel J H van Boom A H Wang 《Nucleic acids research》1990,18(16):4851-4858
The interactions between a novel antitumor drug nogalamycin with the self-complementary DNA hexamer d(CGTACG) have been studied by 500 MHz two dimensional proton nuclear magnetic resonance spectroscopy. When two nogalamycins are mixed with the DNA hexamer duplex in a 2:1 ratio, a symmetrical complex is formed. All non-exchangeable proton resonances (except H5' & H5") of this complex have been assigned using 2D-COSY and 2D-NOESY methods at pH 7.0. The observed NOE cross peaks are fully consistent with the 1.3 A resolution x-ray crystal structure (Liaw et al., Biochemistry 28, 9913-9918, 1989) in which the elongated aglycone chromophore is intercalated between the CpG steps at both ends of the helix. The aglycone chromophore spans across the GC Watson-Crick base pairs with its nogalose lying in the minor groove and the aminoglucose lying in the major groove of the distorted B-DNA double helix. The binding conformation suggests that specific hydrogen bonds exist in the complex between the drug and guanine-cytosine bases in both grooves of the helix. When only one drug per DNA duplex is present in solution, there are three molecular species (free DNA, 1:1 complex and 2:1 complex) in slow exchange on the NMR time scale. This equilibrium is temperature dependent. At high temperature the free DNA hexamer duplex and the 1:1 complex are completely destabilized such that at 65 degrees C only free single-stranded DNA and the 2:1 complex co-exist. At 35 degrees C the equilibrium between free DNA and the 1:1 complex is relatively fast, while that between the 1:1 complex and the 2:1 complex is slow. This may be rationalized by the fact that the binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through. A separate study of the 2:1 complex at low pH showed that the terminal GC base pair is destabilized. 相似文献
2.
3.
A N Lane 《Biochimica et biophysica acta》1990,1049(2):205-212
The conformations of all the nucleotides in the hexamer d(CGTACG)2 have been determined using time-dependent one- and two-dimensional nuclear Overhauser enhancements (NOEs) and the program NUCFIT (see previous article). The glycosidic torsion angles are well determined, the fraction of the C2' endo state for the sugar puckers is less well determined, and the pseudorotation phase angle is poorly determined by the NOEs. The average glycosidic torsion angle is -107 +/- 9 degrees, and the deoxyriboses of the purine residues have a higher fraction of the C2' endo state than those of the pyrimidine residues. There is good agreement between the one- and two-dimensional NOE data. Of the helical parameters, the local rise and twist are moderately well determined, but the roll and tilt of the bases are not well described. The overall structure belongs to the B family of conformations, as previously described by Gronenborn et al. (Biochem. J. (1984) 221, 723-736), but there are significant differences which can be ascribed to the improved treatment of the spin-diffusion and motional averaging possible with the program NUCFIT. The results obtained using NUCFIT are compared with those from restrained energy minimisation calculations using distance restraints obtained from NUCFIT. 相似文献
4.
Determination of the conformation of d(GGAAATTTCC)2 in solution by use of 1H NMR and restrained molecular dynamics 总被引:2,自引:0,他引:2
The conformation of the putative bent DNA d(GGAAATTTCC)2 in solution was studied by use of 1H NMR and restrained molecular dynamics. Most of the resonances were assigned sequentially. A total of 182 interproton distance restraints were determined from two-dimensional nuclear Overhauser effect spectra with short mixing times. Torsion angle restraints for each sugar moiety were determined by qualitative analysis of a two-dimensional correlated spectrum. Restrained molecular dynamics was carried out with the interproton distances and torsion angles incorporated into the total energy function of the system in the form of effective potential terms. As initial conformations for restrained molecular dynamics, classical A-DNA and B-DNA were adopted. The root mean square deviation (rmsd) between these two conformations is 5.5 A. The conformations obtained by use of restrained molecular dynamics are very similar to each other, the rmsd being 0.8 A. On the other hand, the conformations obtained by use of molecular dynamics without experimental restraints or restrained energy minimization depended heavily on the initial conformations, and convergence to a similar conformation was not attained. The conformation obtained by use of restrained molecular dynamics exhibits a few remarkable features. The second G residue takes on the BII conformation [Fratini, A. V., Kopka, M. L., Drew, H. R., & Dickerson, R. E. (1982) J. Biol. Chem. 257, 14686-14707] rather than the standard BI conformation. There is discontinuity of the sugar puckering between the eighth T and ninth C. The minor groove of the oligo(dA) tract is rather compressed. As a result, d(GGAAATTTCC)2 is bent. 相似文献
5.
Proton-proton relaxation rate constants depend on the angle between the internuclear vector and the principal axis of rotation in symmetric top molecules. It is possible to determine to rotational correlation times of the equivalent ellipsoid for DNA fragments from a knowledge of the axial ratio and the cross-relaxation rate constant for the cytosine H6-H5 vectors. The cross-relaxation rate constants for the cytosine H6-H5 vectors have been measured in the 14-base-pair sequence dGCTGTTGACAATTA.dTAATTGTCAACAGC at four temperatures. The results, along with literature data for DNA fragments ranging from 6 to 20 base pairs can be accounted for by a simple hydrodynamic equation based on the formalism of Woessner (1962). The measured cross-relaxation rate constant is independent of position in the sequence and is consistent with the absence of large amplitude internal motions on the Larmor time scale. All the data can be described by a simple hydrodynamic model, which accounts for the rotational anisotropy of the DNA fragments and allows the correlation time for end-over-end tumbling to be determined if the approximate rise per base pair is known. This is the correlation time that dominates the spectral density functions for internucleotide vectors and is significantly different from that calculated for a sphere of the same hydrodynamic volume for fragments containing more than about 14 base pairs. This method therefore allows NOE intensities used for structure calculation of nucleic acids to be treated more rigorously.Offprint requests to: A.N. Lane 相似文献
6.
Recently developed 2H spin relaxation experiments are applied to study the dynamics of methyl-containing side-chains in the B1 domain of protein L and in a pair of point mutants of the domain, F22L and A20V. X-ray and NMR studies of the three variants of protein L studied here establish that their structures are very similar, despite the fact that the F22L mutant is 3.2kcal/mol less stable. Measurements of methyl 2H spin relaxation rates, which probe dynamics on a picosecond-nanosecond time scale, and three-bond 3J(Cgamma-CO), 3J(Cgamma-N) and 3J(Calpha-Cdelta) scalar coupling constants, which are sensitive to motion spanning a wide range of time-scales, reveal changes in the magnitude of side-chain dynamics in response to mutation. Observed differences in the time-scale of motions between the variants have been related to changes in energetic barriers. Of interest, several of the residues with different motional properties across the variants are far from the site of mutation, suggesting the presence of long-range interactions within the protein that can be probed through studies of dynamics. 相似文献
7.
Dong X 《Biochimica et biophysica acta》2003,1625(1):27-29
3-(9-Acridinylamino)-5-(hydroxymethyl)aniline (AHMA) is an anti-cancer agent with significant efficacy against murine leukemia and solid tumors. As a DNA topoisomerase inhibitor, AHMA is proposed to form a ternary complex with DNA and topoisomerase and bind to DNA in an intercalative manner. In order to understand the interactions between AHMA and DNA and study the structure-function relationship of amsacrine analogue, the AHMA-d(CGTACG)(2) complex was crystallized using the sitting-drop vapor-diffusion method. The native crystals diffract to 2.9-A resolution and belong to space group P3(1)21 or P3(2)21 with unit-cell parameters a=b=57.52, c=122.17 A when analyzed using Cu Kalpha radiation. Patterson map indicates that in the crystal, the directions of the DNA base stacking are nearly perpendicular to the c-axis of the crystal unit cell. 相似文献
8.
Summary In this paper we present longitudinal relaxation times, order parameters and effective correlation times for the base and sugar carbons in both strands of the oligonucleotide duplexes d(TCGCG)2 and d(CGCGCG)2, as calculated from 400 ps molecular dynamics trajectories in aqueous solution. The model-free approach (Lipari and Szabo, 1982) was used to determine the amplitudes and time scales of the internal motion. Comparisons were made with NMR relaxation measurements (Borer et al., 1994). The order parameters could acceptably be reproduced, and the effective correlation times were found to be lower than the experimental estimates. Reasonable T1 relaxation times were obtained in comparison with experiment for the nonterminal nucleosides. The T1 relaxation times were found to depend mainly on the order parameters and overall rotational correlation time.Abbreviations MD molecular dynamics - CSA chemical shift anisotropyTo whom correspondence should be addressed. 相似文献
9.
10.
C. A.G. Haasnoot H. P. Westerink G. A. van der Marel J. H. van Boom 《Journal of biomolecular structure & dynamics》2013,31(1):131-149
Abstract The double helical structure of the self-complementary DNA-RNA-DNA hybrid d(CG)r(CG) d(CG) was studied in solution by 500 MHz 1H-NMR spectroscopy. The non-exchangeable base protons and the (deoxy)ribose H1′, H2′ and H2″ protons were unambiguously assigned using 2D-J-correlated (COSY) and 2D-NOE (NOESY) spectroscopy techniques. A general strategy for the sequential assignment of 1H-NMR spectra of (double) helical DNA and RNA fragments by means of 2D-NMR methods is presented. Conformational analysis of the sugar rings of d(CG)r(CG)d(CG) at 300 K shows that the central ribonucleotide part of the helix adopts an A-type double helical conformation. The 5′- and 3′-terminal deoxyribose base pairs, however, take up the normal DNA-type conformation. The A-to-B transition in this molecule involves only one (deoxyribose) base pair. It is shown that this A-to-B conformational transition can only be accomodated by two specific sugar pucker combinations for the junction base pair, i.e. N·S (C3′-endo-C2′-endo, 60%, where the pucker given first is that assigned to the junction nucleotide residue of the strand running 5′ → 3′ from A-RNA to B-DNA) and S·S (C2′-endo-C2′-endo, 40%). 相似文献
11.
Andrew N. Lane Christopher J. Bauer Thomas A. Frenkiel 《European biophysics journal : EBJ》1993,21(6):425-431
Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.Correspondence to: A. N. Lane 相似文献
12.
Multinuclear NMR studies of DNA hairpins. 1. Structure and dynamics of d(CGCGTTGTTCGCG) 总被引:9,自引:0,他引:9
The solution structure of the hairpin formed by d(CGCGTTGTTCGCG) has been examined in detail by a wide variety of NMR techniques. The hairpin was characterized by proton NMR to obtain interproton distances and torsion angle information. An energy-minimized model was constructed that is consistent with these data. The hairpin consists of a B-DNA stem of four C-G base pairs and a loop region consisting of five unpaired bases. Three bases in the 5' of the loop are stacked over the 3' end of the stem, and the other two bases in the 3' of the loop are stacked over the 5' end of the stem. The phosphorus NMR spectrum revealed a phosphate in the stem region with an unusual conformation, and two phosphates, P9 and P10, were found to undergo intermediate exchange between conformations. The hairpin was also synthesized with a carbon-13 label in each of the thymidine C6 carbons, and relaxation measurements were performed to determine the extent of internal motions in the loop region. The loop bases are more flexible than the stem bases and exhibit subnanosecond motions with an amplitude corresponding to diffusion in a cone of approximately 30 degrees. 相似文献
13.
The aim of this work was to study the effect of the type of substituent of the cellulose ethers and the molecular mass on
the state and dynamics of water in the respective hydrogels to specify the quantity of adsorbed water on the polymers or,
more explicitly, to calculate the average number of water molecules bound to a polymer repeating unit (PRU).1H NMR relaxation experiments were performed on equilibrated systems of cellulose ether polymers (HEC, HPC, HPMC K4M, and HPMC
K100M) with water. In particular, the water proton spinlattice (T
1) and spin-spin (T
2) relaxation times were measured in these systems at room temperature. The observed proton NMRT
1 andT
2 of water in hydrogels at different cellulose ether concentrations at room temperature were shown to decrease with increasing
polymer concentration. The relaxation rate 1/T
1 is sensitive to the type of polymer substituent but insensitive to the polymer molecular mass. The rate 1/T
2 appears much less influenced by the polymer substitution. The procedure developed for calculating the amount of water bound
per PRU, based on the analysis of theT
1 andT
2 data, shows that this amount is the largest for HPC followed by HEC, HP MC K4M, and HPMC K100M. The results correlate well
with the degree of hydrophilic substitution of the polymer chains. This NMR analysis deals with a single molecular layer of
adsorbed water for the investigated cellulose ether polymers at all concentrations, while the rest of the water in the hydrogel
is bulk-like. Therefore, the mesh size of polymer network in the view of a single molecular layer is not effectively changed. 相似文献
14.
The local dynamics of a double‐stranded DNA d(TpCpGpCpG)2 is obtained to second order in the mode‐coupling expansion of the Smoluchowski diffusion theory. The time correlation functions of bond variables are derived and the 13C‐nmr spin–lattice relaxation times T1 of different 13C along the chains are calculated and compared to experimental data from the literature at three frequencies. The DNA is considered as a fluctuating three‐dimensional structure undergoing rotational diffusion. The fluctuations are evaluated using molecular dynamics simulations, with the ensemble averages approximated by time averages along a trajectory of length 1 ns. Any technique for sampling the configurational space can be used as an alternative. For a fluctuating three‐dimensional (3D) structure using the three first‐order vector modes of lower rates, higher order basis sets of second‐rank tensor are built to give the required mode coupling dynamics. Second‐ and even first‐order theories are found to be in close agreement with the experimental results, especially at high frequency, where the differences in T1 for 13C in the base pairs, sugar, and backbone are well described. These atomistic calculations are of general application for studying, on a molecular basis, the local dynamics of fluctuating 3D structures such as double‐helix DNA fragments, proteins, and protein–DNA complexes. © 1999 John Wiley & Sons, Inc. Biopoly 50: 613–629, 1999 相似文献
15.
NMR relaxation measurements of 15N spin-lattice relaxation rate (R(1)), spin-spin relaxation rate (R(2)), and heteronuclear nuclear Overhauser effect (NOE) have been carried out at 11.7T and 14.1T as a function of temperature for the side-chains of the tryptophan residues of 15N-labeled and/or (2H,15N)-labeled recombinant human normal adult hemoglobin (Hb A) and three recombinant mutant hemoglobins, rHb Kempsey (betaD99N), rHb (alphaY42D/betaD99N), and rHb (alphaV96W), in the carbonmonoxy and the deoxy forms as well as in the presence and in the absence of an allosteric effector, inositol hexaphosphate (IHP). There are three Trp residues (alpha14, beta15, and beta37) in Hb A for each alphabeta dimer. These Trp residues are located in important regions of the Hb molecule, i.e. alpha14Trp and beta15Trp are located in the alpha(1)beta(1) subunit interface and beta37Trp is located in the alpha(1)beta(2) subunit interface. The relaxation experiments show that amino acid substitutions in the alpha(1)beta(2) subunit interface can alter the dynamics of beta37Trp. The transverse relaxation rate (R(2)) for beta37Trp can serve as a marker for the dynamics of the alpha(1)beta(2) subunit interface. The relaxation parameters of deoxy-rHb Kemspey (betaD99N), which is a naturally occurring abnormal human hemoglobin with high oxygen affinity and very low cooperativity, are quite different from those of deoxy-Hb A, even in the presence of IHP. The relaxation parameters for rHb (alphaY42D/betaD99N), which is a compensatory mutant of rHb Kempsey, are more similar to those of Hb A. In addition, TROSY-CPMG experiments have been used to investigate conformational exchange in the Trp residues of Hb A and the three mutant rHbs. Experimental results indicate that the side-chain of beta37Trp is involved in a relatively slow conformational exchange on the micro- to millisecond time-scale under certain experimental conditions. The present results provide new dynamic insights into the structure-function relationship in hemoglobin. 相似文献
16.
The conformation of the decanucleotide duplex d(GGTAATTACC)2 has been investigated in solution by one- and two-dimensional proton NMR spectroscopy. Intra- and inter-nucleotide two-dimensional nuclear Overhauser enhancement data, recorded at mixing times between 15 and 250 ms, reveal a right-handed B-DNA structure. The data also show that the A-T basepairs of the TAATTA tract are highly propeller twisted and the minor groove is particularly narrow. 相似文献
17.
Platt GW McParland VJ Kalverda AP Homans SW Radford SE 《Journal of molecular biology》2005,346(1):279-294
Many proteins form amyloid-like fibrils in vitro under conditions that favour the population of partially folded conformations or denatured state ensembles. Characterising the structural and dynamic properties of these states is crucial towards understanding the mechanisms of self-assembly in amyloidosis. The aggregation of beta2-microglobulin (beta2m) into amyloid fibrils in vivo occurs in the condition known as dialysis-related amyloidosis (DRA) and the protein has been shown to form amyloid-like fibrils under acidic conditions in vitro. We have used a number of 1H-15N nuclear magnetic resonance (NMR) experiments in conjunction with site-directed mutagenesis to study the acid-unfolded state of beta2m. 15N NMR transverse relaxation experiments reveal that the acid-denatured ensemble, although predominantly unfolded at the N and C termini, contains substantial non-native structure in the central region of the polypeptide chain, stabilised by long-range interactions between aromatic residues and by the single disulphide bond. Relaxation dispersion studies indicate that the acid-unfolded ensemble involves two or more distinct species in conformational equilibrium on the micro- to millisecond time-scale. One of these species appears to be hydrophobically collapsed, as mutations in an aromatic-rich region of the protein, including residues that are solvent-exposed in the native protein, disrupt this structure and cause a consequent decrease in the population of this conformer. Thus, acid-unfolded beta2m consists of a heterogeneous ensemble of rapidly fluctuating species, some of which contain stable, non-native hydrophobic clusters. Given that amyloid assembly of beta2m proceeds with lag kinetics under the conditions of this study, a rarely populated species such as a conformer with non-native aromatic clustering could be key to the initiation of amyloidosis. 相似文献
18.
Intercalation of aflatoxin B1 in two oligodeoxynucleotide adducts: comparative 1H NMR analysis of d(ATCAFBGAT).d(ATCGAT) and d(ATAFBGCAT)2 总被引:3,自引:0,他引:3
8,9-Dihydro-8-(N7-guanyl-[d(ATCGAT)])-9-hydroxyaflatoxin B1.d(ATCGAT) and 8,9-dihydro-8-(N7-guanyl-[d(ATGCAT)])-9-hydroxyaflatoxin B1.8,9-dihydro-8-(N7-guanyl-[d(ATGCAT)])-9-hydroxyaflatoxin B1 were prepared by direct addition of afltoxin B1 8,9-epoxide to d(ATCGAT)2 and d(ATGCAT)2, respectively. In contrast to reaction of aflatoxin B1 8,9-epoxide with d(ATCGAT)2 which exhibits a limiting stoichiometry of 1:1 aflatoxin B1:d(ATCGAT)2 [Gopalakrishnan, S., Stone, M. P., & Harris, T. M. (1989) J. Am. Chem. Soc. 111, 7232-7239], reaction of aflatoxin B1 8,9-epoxide with d(ATGCAT)2 exhibits a limiting stoichiometry of 2:1 aflatoxin B1:d(ATGCAT)2. 1H NOE experiments, nonselective 1H T1 relaxation measurements, and 1H chemical shift perturbations demonstrate that in both modified oligodeoxynucleotides the aflatoxin moiety is intercalated above the 5'-face of the modified guanine. The oligodeoxynucleotides remain right-handed, and perturbation of the B-DNA structure is localized adjacent to the adducted guanine. Aflatoxin-oligodeoxynucleotide 1H NOEs are observed between aflatoxin and the 5'-neighbor base pair and include both the major groove and the minor groove. The aflatoxin methoxy and cyclopentenone ring protons face into the minor groove; the furofuran ring protons face into the major groove. No NOE is observed between the imino proton of the modified base pair and the imino proton of the 5'-neighbor base pair; sequential NOEs between nucleotide base and deoxyribose protons are interrupted in both oligodeoxynucleotide strands on the 5'-side of the modified guanine. The protons at C8 and C9 of the aflatoxin terminal furan ring exhibit slower spin-lattice relaxation as compared to other oligodeoxynucleotide protons, which supports the conclusion that they face into the major groove. Increased shielding is observed for aflatoxin protons; chemical shift perturbations of the oligodeoxynucleotide protons are confined to the immediate vicinity of the adducted base pair. The imidazole proton of the modified guanine exchanges with water and is observed at 9.75 ppm. The difference in reaction stoichiometry is consistent with an intercalated transition-state complex between aflatoxin B1 8,9-epoxide and B-DNA. Insertion of aflatoxin B1-8,9 epoxide above the 5'-face of guanine in d(ATCGAT)2 would prevent the binding of a second molecule of aflatoxin B1 8,9-epoxide. In contrast, two intercalation sites would be available with d(ATGCAT)2.(ABSTRACT TRUNCATED AT 400 WORDS) 相似文献
19.
Nanosecond dynamics simulations for DNA polymerase beta (pol beta)/DNA complexes with three mismatched base-pairs, namely GG, CA, or CC (primer/template) at the DNA polymerase active site, are performed to investigate the mechanism of polymerase opening and how the mispairs may affect the DNA extension step; these trajectories are compared to the behavior of a pol beta/DNA complex with the correct GC base-pair, and assessed with the aid of targeted molecular dynamics (TMD) simulations of all systems from the closed to the open enzyme state. DNA polymerase conformational changes (subdomain closing and opening) have been suggested to play a critical role in DNA synthesis fidelity, since these changes are associated with the formation of the substrate-binding pocket for the nascent base-pair. Here we observe different large C-terminal subdomain (thumb) opening motions in the simulations of pol beta with GC versus GG base-pairs. Whereas the conformation of pol beta in the former approaches the observed open state in the crystal structures, the enzyme in the latter does not. Analyses of the motions of active-site protein/DNA residues help explain these differences. Interestingly, rotation of Arg258 toward Asp192, which coordinates both active-site metal ions in the closed "active" complex, occurs rapidly in the GG simulation. We have previously suggested that this rotation is a key slow step in the closed to open transition. TMD simulations also point to a unique pathway for Arg258 rotation in the GG mispair complex. Simulations of the mismatched systems also reveal distorted geometries in the active site of all the mispair complexes examined. The hierarchy of the distortions (GG>CC>CA) parallels the experimentally deduced inability of pol beta to extend these mispairs. Such local distortions would be expected to cause inefficient DNA extension and polymerase dissociation and thereby might lead to proofreading by an extrinsic exonuclease. Thus, our studies on the dynamics of pol beta opening in mismatch systems provide structural and dynamic insights to explain experimental results regarding inefficient DNA extension following misincorporation; these details shed light on how proofreading may be invoked by the abnormal active-site geometry. 相似文献
20.
Mukti H. Sarma Jia Luo Kimiko Umemoto Ren-da Yuan Ramaswamy H. Sarma 《Journal of biomolecular structure & dynamics》2013,31(6):1131-1153
Abstract The oligonucleotide d(G5T5) can in principle form a fully matched duplex with G · T pairing and/or a tetraplex. Non-denaturing gel electrophoresis, circular dichroism and NMR experiments show that the tetraplex is exclusively formed by this oligomer in solution. In the presence of its complementary strand d(A5C5) at low temperature, d(G5T5) forms the tetraplex over the normally expected Watson-Crick duplex. However, when d(G5T5) and d(A5C5) are mixed together in equimolar amounts and heated for several minutes at 85°C, and then allowed to cool, the product was essentially the Watson-Crick duplex. The lack of resolution in the 500 MHz 1H NMR spectra and the presence of extensive spin diffusion do not allow us to derive a quantitative structure for the tetraplex from the NMR data. However, we find good qualitative agreement between the NOESY and MINSY data and a theoretically derived stereochemically sound structure in which the G's and T's are part of a parallel tetraplex. 相似文献