Internal dynamics of d(CGCAAATTTGCG)2: a comparison of NMR relaxation measurements with a molecular dynamics simulation

We report the analysis of a 250 ps molecular dynamics simulation of the dodecamer d(CGCAAATTT-GCG)₂ immersed in a rectangular box of 3469 water molecules with 22 Na⁺ counterions. The internal dynamics of the molecule were investigated by studying the relevant autocorrelation functions related to the ¹³C-NMR relaxation parameters of the C1′-H1′ bonds of the sugar rings. The calculated effective correlation times τ _e (∼13 ps) and the order parameter S² (∼0.82) of the Lipari and Szabo formalism (Lipari and Szabo 1982a, b) are in satisfactory agreement with those determined previously by NMR (Gaudin et al. 1995, 1996). ¹H-¹H NOE buildups have also been measured experimentally and agree with those computed from the simulation. These results validate the simulation, and a more detailed analysis of the internal dynamics of the dodecamer was undertaken. Analysis of the distributions and of the autocorrelation functions of the glycosidic angle flucuations χ shows that the rotational motion of the sugar rings about their glycosidic bond conforms to a restricted diffusion mechanism. The amplitude of the motions and the diffusion constant are 20° and 17.10⁹ rad²s^–1 respectively. These values are in good agreement with ¹³C NMR data. Furthermore the simulation allows us to rule out another model also consistent with the experiment, consisting of a two-state jump between a syn and an anti conformation. Received: 19 November 1996 / Accepted: 17 March 1997     

NMR studies on the binding of antitumor drug nogalamycin to DNA hexamer d(CGTACG).

The interactions between a novel antitumor drug nogalamycin with the self-complementary DNA hexamer d(CGTACG) have been studied by 500 MHz two dimensional proton nuclear magnetic resonance spectroscopy. When two nogalamycins are mixed with the DNA hexamer duplex in a 2:1 ratio, a symmetrical complex is formed. All non-exchangeable proton resonances (except H5' & H5") of this complex have been assigned using 2D-COSY and 2D-NOESY methods at pH 7.0. The observed NOE cross peaks are fully consistent with the 1.3 A resolution x-ray crystal structure (Liaw et al., Biochemistry 28, 9913-9918, 1989) in which the elongated aglycone chromophore is intercalated between the CpG steps at both ends of the helix. The aglycone chromophore spans across the GC Watson-Crick base pairs with its nogalose lying in the minor groove and the aminoglucose lying in the major groove of the distorted B-DNA double helix. The binding conformation suggests that specific hydrogen bonds exist in the complex between the drug and guanine-cytosine bases in both grooves of the helix. When only one drug per DNA duplex is present in solution, there are three molecular species (free DNA, 1:1 complex and 2:1 complex) in slow exchange on the NMR time scale. This equilibrium is temperature dependent. At high temperature the free DNA hexamer duplex and the 1:1 complex are completely destabilized such that at 65 degrees C only free single-stranded DNA and the 2:1 complex co-exist. At 35 degrees C the equilibrium between free DNA and the 1:1 complex is relatively fast, while that between the 1:1 complex and the 2:1 complex is slow. This may be rationalized by the fact that the binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through. A separate study of the 2:1 complex at low pH showed that the terminal GC base pair is destabilized.     

d(TTTCCTCGCCGGAAA)的一维NMR氢谱分析

单链d(TTTCCTCGCCGGAAA)易溶于水,且由于其本身存在序列特异性,即可形成分子内“发夹”结构,本实验分别测得其在全重水(D2O)、92?O 8%H2O溶液中的一维1H谱,认为环出区域碱基质子的共振峰与其他同种质子的共振峰有明显的区别,主要表现在其共振峰会明显移向高场区。     

Solution conformations of d(CGTACG)2 determined from NMR experiments

The conformations of all the nucleotides in the hexamer d(CGTACG)2 have been determined using time-dependent one- and two-dimensional nuclear Overhauser enhancements (NOEs) and the program NUCFIT (see previous article). The glycosidic torsion angles are well determined, the fraction of the C2' endo state for the sugar puckers is less well determined, and the pseudorotation phase angle is poorly determined by the NOEs. The average glycosidic torsion angle is -107 +/- 9 degrees, and the deoxyriboses of the purine residues have a higher fraction of the C2' endo state than those of the pyrimidine residues. There is good agreement between the one- and two-dimensional NOE data. Of the helical parameters, the local rise and twist are moderately well determined, but the roll and tilt of the bases are not well described. The overall structure belongs to the B family of conformations, as previously described by Gronenborn et al. (Biochem. J. (1984) 221, 723-736), but there are significant differences which can be ascribed to the improved treatment of the spin-diffusion and motional averaging possible with the program NUCFIT. The results obtained using NUCFIT are compared with those from restrained energy minimisation calculations using distance restraints obtained from NUCFIT.     

Determination of the conformation of d(GGAAATTTCC)2 in solution by use of 1H NMR and restrained molecular dynamics

The conformation of the putative bent DNA d(GGAAATTTCC)2 in solution was studied by use of 1H NMR and restrained molecular dynamics. Most of the resonances were assigned sequentially. A total of 182 interproton distance restraints were determined from two-dimensional nuclear Overhauser effect spectra with short mixing times. Torsion angle restraints for each sugar moiety were determined by qualitative analysis of a two-dimensional correlated spectrum. Restrained molecular dynamics was carried out with the interproton distances and torsion angles incorporated into the total energy function of the system in the form of effective potential terms. As initial conformations for restrained molecular dynamics, classical A-DNA and B-DNA were adopted. The root mean square deviation (rmsd) between these two conformations is 5.5 A. The conformations obtained by use of restrained molecular dynamics are very similar to each other, the rmsd being 0.8 A. On the other hand, the conformations obtained by use of molecular dynamics without experimental restraints or restrained energy minimization depended heavily on the initial conformations, and convergence to a similar conformation was not attained. The conformation obtained by use of restrained molecular dynamics exhibits a few remarkable features. The second G residue takes on the BII conformation [Fratini, A. V., Kopka, M. L., Drew, H. R., & Dickerson, R. E. (1982) J. Biol. Chem. 257, 14686-14707] rather than the standard BI conformation. There is discontinuity of the sugar puckering between the eighth T and ninth C. The minor groove of the oligo(dA) tract is rather compressed. As a result, d(GGAAATTTCC)2 is bent.     

Anisotropic rotation in nucleic acid fragments: significance for determination of structures from NMR data

Proton-proton relaxation rate constants depend on the angle between the internuclear vector and the principal axis of rotation in symmetric top molecules. It is possible to determine to rotational correlation times of the equivalent ellipsoid for DNA fragments from a knowledge of the axial ratio and the cross-relaxation rate constant for the cytosine H6-H5 vectors. The cross-relaxation rate constants for the cytosine H6-H5 vectors have been measured in the 14-base-pair sequence dGCTGTTGACAATTA.dTAATTGTCAACAGC at four temperatures. The results, along with literature data for DNA fragments ranging from 6 to 20 base pairs can be accounted for by a simple hydrodynamic equation based on the formalism of Woessner (1962). The measured cross-relaxation rate constant is independent of position in the sequence and is consistent with the absence of large amplitude internal motions on the Larmor time scale. All the data can be described by a simple hydrodynamic model, which accounts for the rotational anisotropy of the DNA fragments and allows the correlation time for end-over-end tumbling to be determined if the approximate rise per base pair is known. This is the correlation time that dominates the spectral density functions for internucleotide vectors and is significantly different from that calculated for a sphere of the same hydrodynamic volume for fragments containing more than about 14 base pairs. This method therefore allows NOE intensities used for structure calculation of nucleic acids to be treated more rigorously. Offprint requests to: A.N. Lane     

The effects of mutations on motions of side-chains in protein L studied by 2H NMR dynamics and scalar couplings

Recently developed 2H spin relaxation experiments are applied to study the dynamics of methyl-containing side-chains in the B1 domain of protein L and in a pair of point mutants of the domain, F22L and A20V. X-ray and NMR studies of the three variants of protein L studied here establish that their structures are very similar, despite the fact that the F22L mutant is 3.2kcal/mol less stable. Measurements of methyl 2H spin relaxation rates, which probe dynamics on a picosecond-nanosecond time scale, and three-bond 3J(Cgamma-CO), 3J(Cgamma-N) and 3J(Calpha-Cdelta) scalar coupling constants, which are sensitive to motion spanning a wide range of time-scales, reveal changes in the magnitude of side-chain dynamics in response to mutation. Observed differences in the time-scale of motions between the variants have been related to changes in energetic barriers. Of interest, several of the residues with different motional properties across the variants are far from the site of mutation, suggesting the presence of long-range interactions within the protein that can be probed through studies of dynamics.     

Crystallization and preliminary X-ray analysis of anti-cancer agent 3-(9-acridinylamino)-5-(hydroxymethyl)aniline complexed with the DNA hexamer d(CGTACG)2

3-(9-Acridinylamino)-5-(hydroxymethyl)aniline (AHMA) is an anti-cancer agent with significant efficacy against murine leukemia and solid tumors. As a DNA topoisomerase inhibitor, AHMA is proposed to form a ternary complex with DNA and topoisomerase and bind to DNA in an intercalative manner. In order to understand the interactions between AHMA and DNA and study the structure-function relationship of amsacrine analogue, the AHMA-d(CGTACG)(2) complex was crystallized using the sitting-drop vapor-diffusion method. The native crystals diffract to 2.9-A resolution and belong to space group P3(1)21 or P3(2)21 with unit-cell parameters a=b=57.52, c=122.17 A when analyzed using Cu Kalpha radiation. Patterson map indicates that in the crystal, the directions of the DNA base stacking are nearly perpendicular to the c-axis of the crystal unit cell.     

Hydration study of homopolypeptides by (2)H NMR

Deuteron T(1) and T(2) was studied as a function of hydration in homopolyglycine (PG) and homopolyproline (PP). Water deuteron relaxation rates in PG conform to a hydration model involving two types of primary hydration sites where water is directly bonded to the polymer. Once these sites are filled, additional water only bonds to water molecules at the primary sites and in so doing affect their dynamics. PP exhibits an anomalous T(1) and T(2) hydration dependence which has been interpreted in terms of a cooperative water molecule-PP molecule helical conformational rearrangement which occurs once a certain hydration level is reached. The proposal of a water-PP structure is tested using molecular dynamics simulations.     

Internal mobility of the ologonucleotide duplexes d(TCGCG)2 and d(CGCGCG)2 in aqueous solution from molecular dynamics simulations

Summary In this paper we present longitudinal relaxation times, order parameters and effective correlation times for the base and sugar carbons in both strands of the oligonucleotide duplexes d(TCGCG)₂ and d(CGCGCG)₂, as calculated from 400 ps molecular dynamics trajectories in aqueous solution. The model-free approach (Lipari and Szabo, 1982) was used to determine the amplitudes and time scales of the internal motion. Comparisons were made with NMR relaxation measurements (Borer et al., 1994). The order parameters could acceptably be reproduced, and the effective correlation times were found to be lower than the experimental estimates. Reasonable T₁ relaxation times were obtained in comparison with experiment for the nonterminal nucleosides. The T₁ relaxation times were found to depend mainly on the order parameters and overall rotational correlation time.Abbreviations MD molecular dynamics - CSA chemical shift anisotropy To whom correspondence should be addressed.     

A diverse view of protein dynamics from NMR studies of HIV-1 protease flaps

Internal motion in proteins fulfills a multitude of roles in biological processes. NMR spectroscopy has been applied to elucidate protein dynamics at the atomic level, albeit at a low resolution, and is often complemented by molecular dynamics simulation. However, it is critical to justify the consistency between simulation results and conclusions often drawn from multiple experiments in which uncertainties arising from assumed motional models may not be explicitly evaluated. To understand the role of the flaps of HIV-1 protease dimer in substrate recognition and protease function, many molecular dynamics simulations have been performed. The simulations have resulted in various proposed models of the flap dynamics, some of which are more consistent than others with our working model previously derived from experiments. However, using the working model to discriminate among the simulation results is not straightforward because the working model was derived from a combination of NMR experiments and crystal structure data. In this study, we use the NMR chemical shifts and relaxation data of the protease "monomer" rather than structural data to narrow down the possible conformations of the flaps of the "dimer". For the first time, we show that the tips of the flaps in the unliganded protease dimer interact with each other in solution. Accordingly, we discuss the consistency of the simulations with the model derived from all experimental data.     

Conformational Analysis of a Hybrid DNA-RNA Double Helical Oligonucleotide in Aqueous Solution: d(CG)r(CG)d(CG) Studied by 1D- and 2D-1H NMR Spectroscopy

Abstract

The double helical structure of the self-complementary DNA-RNA-DNA hybrid d(CG)r(CG) d(CG) was studied in solution by 500 MHz ¹H-NMR spectroscopy. The non-exchangeable base protons and the (deoxy)ribose H1′, H2′ and H2″ protons were unambiguously assigned using 2D-J-correlated (COSY) and 2D-NOE (NOESY) spectroscopy techniques. A general strategy for the sequential assignment of ¹H-NMR spectra of (double) helical DNA and RNA fragments by means of 2D-NMR methods is presented.

Conformational analysis of the sugar rings of d(CG)r(CG)d(CG) at 300 K shows that the central ribonucleotide part of the helix adopts an A-type double helical conformation. The 5′- and 3′-terminal deoxyribose base pairs, however, take up the normal DNA-type conformation. The A-to-B transition in this molecule involves only one (deoxyribose) base pair. It is shown that this A-to-B conformational transition can only be accomodated by two specific sugar pucker combinations for the junction base pair, i.e. N·S (C3′-endo-C2′-endo, 60%, where the pucker given first is that assigned to the junction nucleotide residue of the strand running 5′ → 3′ from A-RNA to B-DNA) and S·S (C2′-endo-C2′-endo, 40%).     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence. Correspondence to: A. N. Lane     

DNA hairpin structures in solution: 500-MHz two-dimensional 1H NMR studies on d(CGCCGCAGC) and d(CGCCGTAGC)

A hairpin structure contains two conformationally distinct domains: a double-helical stem with Watson-Crick base pairs and a single-stranded loop that connects the two arms of the stem. By extensive 1D and 2D 500-MHz 1H NMR studies in H2O and D2O, it has been demonstrated that the DNA oligomers d(CGCCGCAGC) and d(CGCCGTAGC) form hairpin structures under conditions of low concentration, 0.5 mM in DNA strand, and low salt (20 mM NaCl, pH 7). From examination of the nuclear Overhauser effect (NOE) between base protons H8/H6 and sugar protons H1' and H2'/H2", it was concluded that in d(CGCCGCAGC) and d(CGCCGTAGC) all the nine nucleotides display average (C2'-endo,anti) geometry. The NMR data in conjunction with molecular model building and solvent accessibility studies were used to derive a working model for the hairpins.     

Multinuclear NMR studies of DNA hairpins. 1. Structure and dynamics of d(CGCGTTGTTCGCG)

The solution structure of the hairpin formed by d(CGCGTTGTTCGCG) has been examined in detail by a wide variety of NMR techniques. The hairpin was characterized by proton NMR to obtain interproton distances and torsion angle information. An energy-minimized model was constructed that is consistent with these data. The hairpin consists of a B-DNA stem of four C-G base pairs and a loop region consisting of five unpaired bases. Three bases in the 5' of the loop are stacked over the 3' end of the stem, and the other two bases in the 3' of the loop are stacked over the 5' end of the stem. The phosphorus NMR spectrum revealed a phosphate in the stem region with an unusual conformation, and two phosphates, P9 and P10, were found to undergo intermediate exchange between conformations. The hairpin was also synthesized with a carbon-13 label in each of the thymidine C6 carbons, and relaxation measurements were performed to determine the extent of internal motions in the loop region. The loop bases are more flexible than the stem bases and exhibit subnanosecond motions with an amplitude corresponding to diffusion in a cone of approximately 30 degrees.     

Investigation of the state and dynamics of water in hydrogels of cellulose ethers by 1H NMR spectroscopy

The aim of this work was to study the effect of the type of substituent of the cellulose ethers and the molecular mass on the state and dynamics of water in the respective hydrogels to specify the quantity of adsorbed water on the polymers or, more explicitly, to calculate the average number of water molecules bound to a polymer repeating unit (PRU).¹H NMR relaxation experiments were performed on equilibrated systems of cellulose ether polymers (HEC, HPC, HPMC K4M, and HPMC K100M) with water. In particular, the water proton spinlattice (T ₁) and spin-spin (T ₂) relaxation times were measured in these systems at room temperature. The observed proton NMRT ₁ andT ₂ of water in hydrogels at different cellulose ether concentrations at room temperature were shown to decrease with increasing polymer concentration. The relaxation rate 1/T ₁ is sensitive to the type of polymer substituent but insensitive to the polymer molecular mass. The rate 1/T ₂ appears much less influenced by the polymer substitution. The procedure developed for calculating the amount of water bound per PRU, based on the analysis of theT ₁ andT ₂ data, shows that this amount is the largest for HPC followed by HEC, HP MC K4M, and HPMC K100M. The results correlate well with the degree of hydrophilic substitution of the polymer chains. This NMR analysis deals with a single molecular layer of adsorbed water for the investigated cellulose ether polymers at all concentrations, while the rest of the water in the hydrogel is bulk-like. Therefore, the mesh size of polymer network in the view of a single molecular layer is not effectively changed.     

Mode‐coupling Smoluchowski dynamics of a double‐stranded DNA oligomer

The local dynamics of a double‐stranded DNA d(TpCpGpCpG)₂ is obtained to second order in the mode‐coupling expansion of the Smoluchowski diffusion theory. The time correlation functions of bond variables are derived and the ¹³C‐nmr spin–lattice relaxation times T₁ of different ¹³C along the chains are calculated and compared to experimental data from the literature at three frequencies. The DNA is considered as a fluctuating three‐dimensional structure undergoing rotational diffusion. The fluctuations are evaluated using molecular dynamics simulations, with the ensemble averages approximated by time averages along a trajectory of length 1 ns. Any technique for sampling the configurational space can be used as an alternative. For a fluctuating three‐dimensional (3D) structure using the three first‐order vector modes of lower rates, higher order basis sets of second‐rank tensor are built to give the required mode coupling dynamics. Second‐ and even first‐order theories are found to be in close agreement with the experimental results, especially at high frequency, where the differences in T₁ for ¹³C in the base pairs, sugar, and backbone are well described. These atomistic calculations are of general application for studying, on a molecular basis, the local dynamics of fluctuating 3D structures such as double‐helix DNA fragments, proteins, and protein–DNA complexes. © 1999 John Wiley & Sons, Inc. Biopoly 50: 613–629, 1999     

NMR investigation of the dynamics of tryptophan side-chains in hemoglobins

NMR relaxation measurements of 15N spin-lattice relaxation rate (R(1)), spin-spin relaxation rate (R(2)), and heteronuclear nuclear Overhauser effect (NOE) have been carried out at 11.7T and 14.1T as a function of temperature for the side-chains of the tryptophan residues of 15N-labeled and/or (2H,15N)-labeled recombinant human normal adult hemoglobin (Hb A) and three recombinant mutant hemoglobins, rHb Kempsey (betaD99N), rHb (alphaY42D/betaD99N), and rHb (alphaV96W), in the carbonmonoxy and the deoxy forms as well as in the presence and in the absence of an allosteric effector, inositol hexaphosphate (IHP). There are three Trp residues (alpha14, beta15, and beta37) in Hb A for each alphabeta dimer. These Trp residues are located in important regions of the Hb molecule, i.e. alpha14Trp and beta15Trp are located in the alpha(1)beta(1) subunit interface and beta37Trp is located in the alpha(1)beta(2) subunit interface. The relaxation experiments show that amino acid substitutions in the alpha(1)beta(2) subunit interface can alter the dynamics of beta37Trp. The transverse relaxation rate (R(2)) for beta37Trp can serve as a marker for the dynamics of the alpha(1)beta(2) subunit interface. The relaxation parameters of deoxy-rHb Kemspey (betaD99N), which is a naturally occurring abnormal human hemoglobin with high oxygen affinity and very low cooperativity, are quite different from those of deoxy-Hb A, even in the presence of IHP. The relaxation parameters for rHb (alphaY42D/betaD99N), which is a compensatory mutant of rHb Kempsey, are more similar to those of Hb A. In addition, TROSY-CPMG experiments have been used to investigate conformational exchange in the Trp residues of Hb A and the three mutant rHbs. Experimental results indicate that the side-chain of beta37Trp is involved in a relatively slow conformational exchange on the micro- to millisecond time-scale under certain experimental conditions. The present results provide new dynamic insights into the structure-function relationship in hemoglobin.     

Comparison of (13)C(alpha)H and (15)NH backbone dynamics in protein GB1

This study presents a site-resolved experimental view of backbone C(alpha)H and NH internal motions in the 56-residue immunoglobulin-binding domain of streptococcal protein G, GB1. Using (13)C(alpha)H and (15)NH NMR relaxation data [T(1), T(2), and NOE] acquired at three resonance frequencies ((1)H frequencies of 500, 600, and 800 MHz), spectral density functions were calculated as F(omega) = 2omegaJ(omega) to provide a model-independent way to visualize and analyze internal motional correlation time distributions for backbone groups in GB1. Line broadening in F(omega) curves indicates the presence of nanosecond time scale internal motions (0.8 to 5 nsec) for all C(alpha)H and NH groups. Deconvolution of F(omega) curves effectively separates overall tumbling and internal motional correlation time distributions to yield more accurate order parameters than determined by using standard model free approaches. Compared to NH groups, C(alpha)H internal motions are more broadly distributed on the nanosecond time scale, and larger C(alpha)H order parameters are related to correlated bond rotations for C(alpha)H fluctuations. Motional parameters for NH groups are more structurally correlated, with NH order parameters, for example, being larger for residues in more structured regions of beta-sheet and helix and generally smaller for residues in the loop and turns. This is most likely related to the observation that NH order parameters are correlated to hydrogen bonding. This study contributes to the general understanding of protein dynamics and exemplifies an alternative and easier way to analyze NMR relaxation data.