Transfected human beta-polymerase promoter contains a ras-responsive element.

beta-Polymerase is a vertebrate cellular DNA polymerase involved in gap-filling synthesis during some types of genomic DNA repair. We report that a cloned human beta-polymerase promoter in a transient expression assay is activated by p21v-rasH expression in NIH 3T3 cells. A decanucleotide palindromic element, GTGACGTCAC, at positions -49 to -40 in the promoter is required for this ras-mediated stimulation.     

The human kallikrein 10 promoter contains a functional retinoid response element

Human kallikrein 10 (hK10) protein is expressed in normal breast but is significantly downregulated in a majority of invasive breast cancers. Thus, understanding how hK10 expression is regulated is of substantial significance. In this study, we analyzed the promoter region of hK10 using a website software (TRANSFAC 3.0), which predicted three possible retinoic acid response elements (RAREs), RARE1 at -1041 (TGACCTCGTGATCC), RARE2 at -859 (TGACCTCCTATGA) and RARE3 at -765 (TGACCTCCTGTGA), each with a half-site of a canonical sequence (TGACCT; reverse complement AGGTCA). Using electrophoretic mobility shift assays and nucleotide competition analysis, as well as chromatin immunoprecipitation of the native hK10 promoter, we demonstrated specific binding of RXR only to RARE1. The functional importance of RARE in the hK10 promoter was demonstrated by retinoid induction of hk10 promoter-reporters; furthermore, mutation of RARE1 but not of RARE2 or RARE3 abolished the induction of the reporter. Finally, we demonstrated the induction of hK10 mRNA and protein expression upon retinoid treatment of cells. In view of the correlation of the downregulation of hK10 mRNA and protein with breast cancer progression, these findings suggest a potential approach to restore hK10 expression in cancer patients.     

The tetracycline-responsive promoter contains functional interferon-inducible response elements

Tetracycline (tet)-responsive expression vectors allow controlled inducible expression of proteins in mammalian cells. This system is widely used for experimental research both in vivo and in vitro. In our attempts to use this system to study the antiviral effect of IFNα on hepatitis B virus, we discovered an unexpected feature of the tet-responsive promoter (tet promoter) of the currently available expression vectors. IFNα was found to stimulate tet promoter activity after transient transfection in a dose- and cell type-dependent manner. By sequence inspection, an IFNα-stimulated response element (ISRE)-like sequence was identified in the linker regions located between the heptameric tet operator sequences. Gel shift assays revealed binding of IFN-stimulated gene factors to these sequences, indicating that they mediate the IFNα-mediated promoter stimulation. These data demonstrate an unexpected feature of the tet-responsive expression system which needs to be taken into acount when using this system for analysis of cytokine functions in vitro and in vivo. The data also imply that the tet promoter-based expression system can be rendered non-responsive to IFNα by mutagenesis of the ISREs and this may be essential when considering gene therapy in vivo.     

Protein binding elements in the human beta-polymerase promoter.

The core promoter for human DNA polymerase beta contains discrete binding sites for mammalian nuclear proteins, as revealed by DNasel footprinting and gel mobility shift assays. Two sites correspond to sequences identical with the Sp1 factor binding element, and a third site includes an eight residue palindromic sequence, TGACGTCA, known as the CRE element of several cAMP responsive promoters; the 5 to 10 residues flanking this palindrome on each side have no apparent sequence homology with known elements in other promoters. Nuclear extract from a variety of tissues and cells were examined; these included rat liver and testes and cultured cells of human and hamster origin. The DNasel footprint is strong over and around the palindromic element for each of the extracts and is equivalent in size (approximately 22 residues); footprinting over the Sp1 binding sites is seen also. Two potential tissue-specific binding sites, present in liver but not in testes, were found corresponding to residues -13 to -10 and +33 to +48, respectively. Protein binding to the palindromic element was confirmed by an electrophoretic mobility shift assay with the core promoter as probe. Binding specificity of the 22 residue palindromic element, as revealed by oligonucleotide competition, is different from that of AP-1 binding element. Controlled proteolysis with trypsin was used to study structural properties of proteins forming the mobility shift bands. Following digestion with trypsin, most of the palindrome binding activity of each extract corresponded to a sharp, faster migrating band, potentially representing a DNA binding domain of the palindrome binding protein.     

A new cAMP response element in the transcribed region of the human c-fos gene.

In NIH 3T3 cells the c-fos gene is induced rapidly and transiently by cAMP. As shown by the analysis of 3T3 cells stably transfected with promoter mutants of the human c-fos gene this induction does not depend on the dyad symmetry element (position -320 to -300), but involves at least two other non-related sites: an element located around position -60 resembling the cAMP response element of the fibronectin and somatostatin genes (which has been described before), and an element located between positions +18 and +38. Destruction of one or the other element in the c-fos gene reduces cAMP inducibility. The cAMP response of c-fos promoter CAT gene constructs also depends on these elements in transient transfection assays. When cloned in front of the albumin TATA box, both elements independently mediate cAMP inducibility. These elements do not bind the same protein as shown in gel retardation analyses, suggesting that two different cAMP inducible factors mediate the activation of the c-fos gene by cAMP.     

Identification of a Vitamin D response element in the human insulin receptor gene promoter

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.     

The uteroglobin promoter contains a noncanonical estrogen responsive element

Uteroglobin is expressed in various tissues of the rabbit under complex hormonal control. In the endometrium the uteroglobin gene is transcribed only in epithelial cells after administration of ovarian hormones. In this paper we demonstrate that within the promoter region of the rabbit uteroglobin gene, there is a functional estrogen-responsive element (ERE) located between -265 and -252. Hybrid constructions containing sequences of the uteroglobin promoter up to -299, linked to the chloramphenicol acetyltransferase gene of E. coli respond to estrogens in gene transfer experiments, whereas a deletion that removes half of the ERE does not. A synthetic oligonucleotide corresponding to the putative ERE is able to confer estrogen inducibility to an otherwise unresponsive promoter. Binding experiments with purified estrogen receptor from calf uterus reveal a DNase-I footprint over the ERE. Within this protected region six guanine residues that have been shown to be contacted by the receptor in other EREs are protected against methylation by dimethylsulfate in the presence of the estrogen receptor. We compare this ERE with the vitellogenin A2 ERE from Xenopus and find that the relative affinity of the uteroglobin ERE is slightly lower than that of the vitellogenin ERE. Thus, this uteroglobin ERE could be involved in physiological regulation of uteroglobin expression in the genital tract.