Binding of bis-linked netropsin derivatives in the parallel-stranded hairpin form to DNA

Cis-diammine Pt(II)- bridged bis-netropsin and oligomethylene-bridged bis-netropsin in which two monomers are linked in a tail-to-tail manner bind to the DNA oligomer with the sequence 5'-CCTATATCC-3' in a parallel-stranded hairpin form with a stoichiometry 1:1. The difference circular dichroism (CD) spectra characteristic of binding of these ligands in the hairpin form are similar. They differ from CD patterns obtained for binding to the same duplex of another bis-netropsin in which two netropsin moieties were linked in a head-to-tail manner. This reflects the fact that tail-to-tail and head-to-tail bis-netropsins use parallel and antiparallel side-by-side motifs, respectively, for binding to DNA in the hairpin forms. The binding affinity of cis-diammine Pt(II)-bridged bis-netropsin in the hairpin form to DNA oligomers with nucleotide sequences 5'-CCTATATCC-3' (I), 5'-CCTTAATCC-3' (II), 5'-CCTTATTCC-3' (III), 5'-CCTTTTTCC-3' (IV) and 5'-CCAATTTCC-3' (V) decreases in the order I = II > III > IV > V . The binding of oligomethylene-bridged bis-netropsin in the hairpin form follows a similar hierarchy. An opposite order of sequence preferences is observed for partially bonded monodentate binding mode of the synthetic ligand.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Total synthesis of the structural gene for the precursor of a tyrosine suppressor transfer RNA from Escherichia coli. 11. Enzymatic joining to form the total DNA duplex.

The DNA duplex corresponding to the entire length (126 nucleotides) of the precursor for an Escherichia coli tyrosine tRNA has been synthesized. Duplex [I] (Sekiya, T., Besmer, P., Takeya, T., and Khorana, H. G.(1976) J. Biol. Chem. 251, 634-641), corresponding to the nucleotide sequence 1-26, containing single-stranded ends and carrying one appropriately labeled 5'-phosphate group, was joined to duplex [II] (Loewen, P. C., Miller, R. C., Panet, A., Sekiya, T., and Khorana, H. G. (1976) J. Biol. Chem. 251, 642-650) (nucleotide sequence 23-66 or 23-60) was phosphorylated with [gamma-33P]ATP at the 5'-OH ends. Duplex [III] (Panet, A., Kleppe, R., Kleppe, K., and Khorana, H. G. (1976) J. Biol. Chem. 251, 651-657) (nucleotide sequence 57-94 (Fig. 2)) was also phosphorylated at 5'-ends with [gamma-33P]ATP and was joined to duplex [IV] (Caruthers, M. H., Kleppe, R., Kleppe, K., and Khorana, H. G. (1976) J. Biol. Chem. 251, 658-666) (nucleotide sequence 90-126) which carried a 33P-labeled phosphate group on nucleotide 90. The joined product, duplex [III + IV] (nucleotide sequence 57-126) was characterized. The latter duplex was joined to the duplex [I + II] to give the total duplex. The latter contains singlestranded ends (nucleotides 1 to 6 and 121 to 126) which can either be "filled in" to produce the completely base-paired duplex or may be used to add the promoter and terminator regions at the appropriate ends.     

Kinetics of enzymic reductive deiodination of iodothyronines. Effect of pH.

5'-Deiodination of thyroxine (yielding 3,3',5-tri-iodothyronine; reaction I) and of 3,3',5'-tri-iodothyronine (yielding 3,3'-di-iodothyronine; reaction II) and 5-deiodination of thyroxine (yielding 3,3',5'-tri-iodothyronine; reaction III) and of 3,3',5-tri-iodothyronine (yielding 3,3'-di-iodothyronine; reaction IV) as catalysed by rat liver microsomal fraction were studied at pH 6.5, 7.2 and 8.0 It was found that: (1) the Km of reaction I was relatively independent of pH (approx. 3 microM), whereas V was highest at pH 6.5 (63 pmol of 3,3',5-tri-iodothyronine/min per mg of protein); (2) the Km of reaction II was lowest at pH 6.5 (0.035 microM), but V was highest at pH 8.0 (829 pmol of 3,3'-di-iodothyronine/min per mg of protein); (3) thyroxine inhibited reaction II competitively; Ki values were identical at pH 6.5 and 8.0 (1 microM); (4) for both reactions III and IV Km was lowest and V was highest at pH 8.0. The results are compatible with the view that reactions I and II are mediated by a single enzyme (iodothyronine 5'-deiodinase) and that reactions III and IV are catalysed by a second enzyme (iodothyronine 5-deiodinase).     

5' terminal nucleotide sequences of the messenger RNA's of Dictyostelium discoideum.

As in the mRNA from all other eucaryotic cells examined, the 5' nucleotide in messenger RNA from Dictyostelium discoideum is linked by a 5'-5' triphosphate bridge to the unusual nucleoside 7-methyl guanosine. In mammalian cellular mRNA, the 5' terminal sequences have the general formula m7GpppXmpYp(m), where X and Y can be either purine or pyrimidine nucleotides and Y, as well as X, may contain a 2'0-methylated ribose. Although at least 32 5' terminal sequences are possible in cellular mRNA, only four are present in Dictyostelum mRNA. They are (I) m7GppppAp (65%); (II) m7GpppGp (10%); (III) m7GpppAmpAp (10%); (IV m7GpppAp (65%); (II) m7gpppGp (10%); (III) m7GpppAmpAp (10%); (IV) m7GpppAmpUp (10%). Sequences I and II are simpler than those previously reported for mammalian cells because they lack 2'0-methylated nucleosides. Another difference is that in all Dictyostelium mRNAs. the nucleoside X is a purine. The nucleoside 6-methyl adenosine which is found internal to the 5' end of the mRNA of mammalian cells is not detectable in Dictyostelium mRNA. Thus neither 2'0-methylated nucleotides nor 6-methyl adenosine can represent sites for processing of a primary nuclear transript to yield mRNA.     

Deuteriation of sugar protons simplify NMR assignments and structure determination of large oligonucleotide by the 1H-NMR window approach.

The concept of the 1H-NMR window has been developed and examined through a comparative study of NOESY spectra of a self-complementary Dickerson's dodecamer (I) [5'd(5C6G7C8G9A10A11T12T13C-14G15C16G)2(3')], a self-complementary 20-mer (II) [(5'd(1C2G3C4G5C6G7C8G9A10A11T12T13C14G15C16G17C18G19C20G)2(3')] in which the core part consists of the same Dickerson's dodecamer sequence with the flanking CGCG residues at both 3' and 5'-ends, and the partly-deuteriated (shown by underlined CGCG residues at both 3' and 5'-ends) analogous duplex (III) [5'd(1C2G3C4G5C6G7C8G9A10A11T12T13C14G15C16G17C18G19C20G)2(3')] in which the core 5C to 16G part (i.e. 1H-NMR window) consists of the natural Dickerson's dodecamer sequence. A comparison of their NOESY spectra clearly demonstrates that the severe overlap of proton resonances in the larger DNA duplex (II) has been successfully reduced in the partly-deuterated duplex (III) as a result of specific incorporations of the sugar-deuteriated nucleotide residues in the latter [stereospecific > 97 atom % 2H enrichment at H2', H2' and H3' sites, approximately 85 atom % 2H enrichment at H4' and approximately 20 atom % 2H enrichment at H1' (see refs. 10 and 11) in the 20-mer duplex (III)]. These simplifications of the resonance overlap by the deuteriation approach have enabled unequivocal chemical shift assignments and extraction of the quantitative NOE data in the 1H-NMR window part of duplex (III). A comparison of the 12-nucleotide long 1H-NMR window in (III) with that of the 12-mer duplex (I) also shows the scope of studying the changes in conformation and dynamics of the core 12-mer region in (III) which result from the increase of molecular weight due to the DNA chain extension. It is noteworthy that such a study is clearly impossible for the natural 20-mer (II) because of the inherent problem of the overlap of resonances.     

Expression of three mRNA species from a single rat aldolase A gene, differing in their 5' non-coding regions

The complete nucleotide sequence of the rat aldolase A isozyme gene, including the 5' and 3' flanking sequences, was determined. The gene comprises ten exons, spans 4827 base-pairs and occurs in a single copy per haploid rat genome. The genomic DNA sequence was compared with those of three species of rat aldolase A mRNA (mRNAs I, II and III) that have been found to differ from each other only in the 5' non-coding region and to be expressed tissue-specifically. It revealed that the first exon (exon M1) encodes the 5' non-coding sequence of mRNA I, while the second exon (exon AH1) encodes those of mRNAs II and III and the following eight exons (exons 2 to 9) are shared commonly by all the mRNA species. These results allowed us to conclude that mRNA I and mRNAs II, III were generated from a single aldolase A gene by alternative usage of exon M1 or exon AH1 in addition to exons 2 to 9. S1 nuclease mapping of the 5' ends of their precursor RNAs suggested that these three mRNA species were transcribed from three different initiation sites on the single gene.     

Influence of dangling thymidine residues on the stability and structure of two DNA duplexes

We have employed temperature-dependent UV spectroscopy, circular dichroism (CD), 400-MHz proton nuclear magnetic resonance (NMR), and computer modeling to characterize both structurally and thermodynamically the influence of unpaired, dangling thymidine residues (T) on the thermal stability and melting behavior of two DNA core duplexes. The specific DNA double helices that we have investigated in this work are core duplexes [d(GC)3]2 (I) and [d(CG)3]2 (IV), 3' dangling T derivatives [d[(GC)3TT]]2 (II) and [d[(CG)3TT]]2 (V), and 5' dangling T derivatives [d[TT(GC)3]]2 (III) and [d[TT(CG)3]]2 (VI). Our experimental data allow us to reach the following conclusions: (1) For both core duplexes (I and IV), the addition of dangling T residues on either the 5' or 3' end causes an increase in the optical melting temperature tm. (2) For both core duplexes, 5' dangling T residues induce a greater increase in the optical tm's than 3' dangling T residues. (3) For both cores duplexes, the increase in tm induced by the addition of dangling T residues is enthalpic in origin, with 5' dangling T residues inducing a greater increase in the van't Hoff transition enthalpy than 3' dangling T's. (4) Dangling T residues cause downfield shifts in all of the nonexchangeable aromatic protons of the [d(GC)3]2 core duplex (I), with the 5' T residues inducing the largest shifts. For the most part, this trend does not hold with the [d(CG)3]2 core duplex (IV). (5) For both core duplexes, the addition of dangling T residues causes an increase in the NMR tm's of almost all the nonexchangeable aromatic protons of the core duplex.(ABSTRACT TRUNCATED AT 250 WORDS)     

Structure, biological activity and membrane partitioning of analogs of the isoprenylated a-factor mating peptide of Saccharomyces cerevisiae.

Previous biochemical investigations on the Saccharomyces cerevisiae a-factor indicated that this lipopeptide pheromone [YIIKGVFWDPAC(farnesyl)OMe] might adopt a type II beta-turn at positions 4 and 5 of the peptide sequence. To test this hypothesis, we synthesized five analogs of a-factor, in which residues at positions 4 and 5 were replaced with: L-Pro4(I); D-Pro4(II); L-Pro4-D-Ala5(III); D-Pro4-L-Ala5(IV); or Nle4(V). Analogs were purified to > 99% homogeneity as evidenced by HPLC and TLC and were characterized by mass spectrometry and amino acid analysis. Using a growth arrest assay the conformationally restricted a-factor analogs I and III were found to be almost 50-fold more active than the diastereometric homologs II and IV and were equally active to wild-type a-factor. Replacement of Lys4 with the isosteric Nle4 almost abolished the activity of the pheromone. Thus, the incorporation of residues that promote a type II beta-turn compensated for the loss of the favorable contribution of the Lys4 side chain to pheromone activity. CD spectra on these peptides suggested that they were essentially disordered in both TFE/H2O and in the presence of DMPC vesicles. There was no correlation between CD peak shape and biological activity. Using fluorescence spectroscopy we measured the interaction of lipid vesicles with these position 4 and 5 analogs as well as with three a-factor analogs with a modified farnesyl group. The results indicated that modifications of both the peptide sequence and the lipid moiety affect partitioning into lipid, and that no correlation existed between the propensity of a pheromone to partition into the lipid and its biological activity.