共查询到20条相似文献,搜索用时 15 毫秒
1.
Richard B. Kennedy Inna G. Ovsyannikova Iana H. Haralambieva Nathaniel D. Lambert V. Shane Pankratz Gregory A. Poland 《Immunogenetics》2014,66(7-8):493-499
Genetic polymorphisms are known to affect responses to both viral infection and vaccination. Our previous work has described genetic polymorphisms significantly associated with variations in immune response to rubella vaccine from multiple gene families with known immune function, including HLA, cytokine and cytokine receptor genes, and in genes controlling innate and adaptive immunity. In this study, we assessed cellular immune responses (IFNγ and IL-6) in a cohort of healthy younger individuals and performed genome-wide SNP analysis on these same individuals. Here, we report the first genome-wide association study focused on immune responses following rubella vaccination. Our results indicate that rs16928280 in protein tyrosine phosphatase delta (PTPRD) and a collection of SNPs in ACO1 (encoding an iron regulatory protein) are associated with interindividual variations in IFNγ response to rubella virus stimulation. In contrast, we did not identify any significant genetic associations with rubella-specific IL-6 response. These genetic regions may influence rubella vaccine-induced IFNγ responses and warrant further studies in additional cohorts in order to confirm these findings. 相似文献
2.
Inna G. Ovsyannikova Hannah M. Salk Beth R. Larrabee V. Shane Pankratz Gregory A. Poland 《Immunogenetics》2014,66(11):663-669
Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response. 相似文献
3.
Ghada Alsaleh Laetitia Sparsa Emmanuel Chatelus Mathieu Ehlinger Jacques-Eric Gottenberg Dominique Wachsmann Jean Sibilia 《Arthritis research & therapy》2010,12(4):R135-11
Introduction
Interleukin-32 (IL-32) is a recently described cytokine that is a strong inducer of pro-inflammatory cytokines such as tumor necrosis factor (TNF)-α, IL-1β, IL-6, and IL-8. The expression of this cytokine is highly increased in the rheumatoid synovium and correlated with the severity of joint inflammation. Little is known regarding the innate immune-related regulation of IL-32 by fibroblast-like synoviocytes (FLSs). We therefore investigated the effect of innate immune stimulation by ligands of Toll-like receptor (TLR)2, TLR3, and TLR4, and cytokines such as TNF-α and interferon (IFN)-γ, on IL-32 expression by FLSs. 相似文献4.
Neelam Dhiman Iana H. Haralambieva Richard B. Kennedy Robert A. Vierkant Megan M. O’Byrne Inna G. Ovsyannikova Robert M. Jacobson Gregory A. Poland 《Immunogenetics》2010,62(4):197-210
An effective immune response to vaccination is, in part, a complex interaction of alleles of multiple genes regulating cytokine
networks. We conducted a genotyping study of Th1/Th2/inflammatory cytokines/cytokine receptors in healthy children (n = 738, 11–19 years) to determine associations between individual single-nucleotide polymorphisms (SNPs)/haplotypes and immune
outcomes after two doses of rubella vaccine. SNPs (n = 501) were selected using the ldSelect-approach and genotyped using Illumina GoldenGate™ and TaqMan assays. Rubella-IgG
levels were measured by immunoassay and secreted cytokines by ELISA. Linear regression and post hoc haplotype analyses were
used to determine associations between single SNPs/haplotypes and immune outcomes. Increased carriage of minor alleles for
the promoter SNPs (rs2844482 and rs2857708) of the TNFA gene were associated with dose-related increases in rubella antibodies. IL-6 secretion was co-directionally associated (p ≤ 0.01) with five intronic SNPs in the TNFRSF1B gene in an allele dose-related manner, while five promoter/intronic SNPs in the IL12B gene were associated with variations in IL-6 secretion. TNFA haplotype AAACGGGGC (t-statistic = 3.32) and IL12B promoter haplotype TAG (t-statistic = 2.66) were associated with higher levels of (p ≤ 0.01) rubella-IgG and IL-6 secretion, respectively. We identified individual SNPs/haplotypes in TNFA/TNFRSF1B and IL12B genes that appear to modulate immunity to rubella vaccination. Identification of such “genetic fingerprints” may predict
the outcome of vaccine response and inform new vaccine strategies. 相似文献
5.
Balzer Sandrock Karen M. Hudson Douglas E. Williams Michael A. Lieberman 《In vitro cellular & developmental biology. Animal》1996,32(4):225-233
Summary The regulation of megakaryopoeisis by cytokines is not yet well understood. It is possible that autocrine loops are established
during megakaryocyte growth and differentiation, aiding in the maturation of these cells. The CHRF-288-11 human megakaryoblastic
cell line has been examined for cytokine production in growing cells and cells stimulated to differentiate by the addition
of phorbol esters. It has been demonstrated that these cells produce RNA corresponding to the interleukins IL-1α, 1β, 3, 7,
8, and 11, granulocyte-macrophage colony stimulating factor (GM-CSF), stem cell factor (SCF), transforming growth factor-β
(TGF-β), tumor necrosis factor-α (TNF-α), interferon-α (INF-α), and basic fibroblast growth factor (bFGF). Additionaly, RNA
corresponding to the receptors for IL-6, GM-CSF, SCF, INF-α,β, bFGF, and monocyte colony stimulating factor (M-CSF) were also
expressed by the cells. The receptor for TNF-α was detected immunologically. Analysis at the protein level demonstrated that
significant amounts of INF-α, TNF-α, GM-CSF, SCF, IL-1α, and a soluble form of the IL-6 receptor were produced by the cells.
Addition of phorbol esters to CHRF-288-11 cells enhances their megakaryocytic phenotype; such treatment also results in increased
secretion of INF-α, TNF-α, and GM-CSF. These results suggest that potential autocrine loops are established during the differentiation
of CHRF-288-11 cells, which may alter the capability of the cell to differentiate. These findings are similar to those recently
obtained for marrow-derived megakaryocytes (Jiang et al.) suggesting that CHRF-288-11 cells provide a useful model system
for the study of cytokine release during megakaryocyte differentiation. 相似文献
6.
Clifford HD Yerkovich ST Khoo SK Zhang G Upham J Le Souëf PN Richmond P Hayden CM 《Immunogenetics》2012,64(3):219-228
Successful defence against viral pathogens requires the rapid recognition of virus-specific “danger signals” and the activation
of both innate and adaptive immunity. Toll-like receptors (TLR) 7 and 8 play a critical role in the elimination of viruses
by recognising the common viral component, single stranded (ss)RNA. Measles virus, an ssRNA virus, continues to cause serious
morbidity and mortality worldwide despite available measles vaccines. TLR7 and TLR8 genetic variation may cause functional alterations that result in impaired responses to measles. In a population of 12-month-old
Australian infants, receptor protein expression was examined to assess the functionality of TLR7 and TLR8 polymorphisms, and the effects of these polymorphisms on cellular and antibody responses after the first measles vaccine
dose were investigated. TLR7 Leu11Gln showed associations with TNF-α responses after ligand (imiquimod) stimulation in males only (P = 0.040), and non-responders were more likely to be Gln males (P = 0.044). TNF-α non-responders after imiquimod also had higher percentages of TLR8 -4284TT (69.6%) (P = 0.001) and TLR8 -558CC (69.6%) (P = 0.002) in females. Receptor protein expression after imiquimod or measles stimulation was not significantly altered compared
with baseline, nor was it affected by genotype. None of the TLR7 or TLR8 polymorphisms studied were associated with measles-specific cytokine levels or with measles IgG levels. In conclusion, we
report gender-specific associations with TLR7 and TLR8 polymorphisms and TNF-α cellular responses to its ligand. However, we found no evidence of any functional effects of TLR7 or TLR8 polymorphisms on receptor expression, measles-specific cellular responses or measles vaccine antibody responses. 相似文献
7.
Shin DM Yang CS Yuk JM Lee JY Kim KH Shin SJ Takahara K Lee SJ Jo EK 《Cellular microbiology》2008,10(8):1608-1621
Mycobacterium abscessus (Mab) is an emerging and rapidly growing non-tuberculous mycobacterium (NTM). Compared with M. tuberculosis , which is responsible for tuberculosis, much less is known about NTM-induced innate immune mechanisms. Here we investigated the involvement of pattern-recognition receptors and associated signalling in Mab-mediated innate immune responses. Mab activated the extracellular signal-regulated kinase (ERK)1/2 and p38 mitogen-activated protein kinases (MAPKs), and induced the secretion of tumour necrosis factor-α, interleukin (IL)-6 and IL-12p40 in murine macrophages via Toll-like receptor (TLR) 2. Notably, the activation of ERK1/2, but not p38, was crucial for Mab-induced pro-inflammatory cytokine production. The ITAM-like motif of dectin-1 critically contributed to Mab internalization and cytokine secretion by macrophages. In addition, dectin-1, in cooperation with TLR2, was required for the efficient phagocytosis of Mab, ERK1/2 activation and pro-inflammatory cytokine secretion. Co-immunoprecipitation and confocal analysis showed the physical interaction and colocalization of dectin-1 with TLR2 following Mab stimulation. Moreover, dectin-1-induced Syk activation was essential for the production of inflammatory cytokines and the release of reactive oxygen species by Mab-infected macrophages. Collectively, these data demonstrate that Mab actively internalizes into and robustly activates innate immune responses in macrophages through a physical and functional interaction between TLR2 and dectin-1. 相似文献
8.
Toll-like receptors (TLRs) play roles in innate and adaptive immune responses. Some TLRs are involved in the pathogenesis
of cardiovascular diseases. Coronary artery disease (CAD) has an inflammatory and immunological basis. We investigated whether
TLR8 Met1Val and TLR8-129G>C single nucleotide polymorphisms (SNPs rs3764879 and rs3764880) are associated with CAD in the
Chinese population. We enrolled 412 consecutive patients (185 with coronary stenosis ≥50% or previous myocardial infarction
and 227 controls). Ligase detection reaction was performed to detect SNPs rs3764879 and rs3764880 of TLR8. The SNP at rs3764879
is in complete linkage disequilibrium with rs3764880. No significant difference was found in genotypic or allelic frequencies
of these two common SNPs between CAD cases and controls (P > 0.05, respectively). No associations existed between these two SNPs and the severity of coronary artery stenosis (All P > 0.05). These results do not support an involvement of SNPs rs3764879 and rs3764880 of TLR8 in predisposition to CAD.
Z. Chen and G. Ma contributed equally to this paper. 相似文献
9.
10.
JA Shah JC Vary TT Chau ND Bang NT Yen JJ Farrar SJ Dunstan TR Hawn 《Journal of immunology (Baltimore, Md. : 1950)》2012,189(4):1737-1746
Tuberculosis, one of the leading causes of death worldwide, stimulates inflammatory responses with beneficial and pathologic consequences. The regulation and nature of an optimal inflammatory response to Mycobacterium tuberculosis remains poorly understood in humans. Insight into mechanisms of negative regulation of the TLR-mediated innate immune response to M. tuberculosis could provide significant breakthroughs in the design of new vaccines and drugs. We hypothesized that TOLLIP and its common variants negatively regulate TLR signaling in human monocytes and are associated with susceptibility to tuberculosis. Using short hairpin RNA knockdown of TOLLIP in peripheral blood human monocytes, we found that TOLLIP suppresses TNF and IL-6 production after stimulation with TLR2 and TLR4 ligands. In contrast, secretion of the anti-inflammatory cytokine IL-10 was induced by TOLLIP. We also discovered two common polymorphisms that are associated with either decreased levels of mRNA expression (rs3750920) or increased IL-6 production (rs5743899) in a sample of 56 healthy volunteers. Furthermore, in a case-population study in Vietnam with 760 cord blood samples and 671 TB case patients, we found that SNPs rs3750920 and rs5743899 were associated with susceptibility to tuberculosis (p = 7.03 × 10(-16) and 6.97 × 10(-7), respectively). These data demonstrate that TOLLIP has an anti-inflammatory effect on TLR signaling in humans and that TOLLIP deficiency is associated with an increased risk of tuberculosis. To our knowledge, these data also show the first associations of TOLLIP polymorphisms with any infectious disease. These data also implicate an unexpected mechanism of negative regulation of TLR signaling in human tuberculosis pathogenesis. 相似文献
11.
12.
Cheng C Qin Y Shao X Wang H Gao Y Cheng M Shen A 《Cellular and molecular neurobiology》2007,27(7):909-921
Mitogen-activated protein kinases (MAPKs) are important mediators of cytokine expression and are critically involved in the
immune response. The lipopolysaccharide (LPS) of gram-negative bacteria induces the expression of cytokines and proinflammatory
genes via the toll-like receptor 4 (TLR4) signaling pathway in diverse cell types. In vivo, Schwann cells (SCs) at the site
of injury may also produce tumor necrosis factor-- α (TNF-α). However, the precise mechanisms of TNF-α synthesis are still
not clear. The purpose of the present study was to elucidate the underlying molecular mechanisms in the cultured SCs for its
ability to activate the MAPKs and TNF-α gene, in response to LPS. Using enzyme-linked immunosorbent assay (ELISA), it was
confirmed that treatment with LPS stimulated the synthesis of TNF-α in a concentration- and time-dependent manner. Intracellular
location of TNF-α was detected under confocal microscope. Moreover, LPS activated extracellular signal-regulated kinase (ERK1/2),
P38 and stress activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) and induced their phosphorylation. LPS-elicited
SCs TNF-α production was also drastically suppressed by PD98059 (ERK inhibitor), SB202190 (P38 inhibitor), or SP600125 (SAPK/JNK
inhibitor). Additionally, the expression of CD14 and TLR4 was examined by RT–PCR. It was demonstrated that the expression
of CD14, TLR4 was crucial for the SCs responses to LPS. In conclusion, the results provide novel mechanisms for the response
of SCs to LPS stimulation, through MAPKs signaling pathways.
Chun Cheng and Yongwei Qin contributed equally to this work. 相似文献
13.
Daniel H. Libraty Lei Zhang Marcia Woda Luz P. Acosta AnaMae Obcena Job D. Brion Rosario Z. Capeding 《PloS one》2013,8(10)
Infants have long been known to have higher infectious diseases morbidity and mortality and suboptimal vaccination responses compared to older children and adults. A variety of differences in innate and adaptive immune responses have been described between these two groups. We compared Toll-like receptor (TLR)-induced production of pro-interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α between 2-month-old infants and adults. TLR 7/8-induced production of pro-IL-1β and IL-6 in monocytes was lower in 2-month-old infants compared to adults. There was no difference in TLR 7/8-induced production of TNF-α. Lower TLR-induced production of pro-IL-1β and IL-6 in innate immune cells during early infancy likely contributes to suboptimal vaccine responses and infectious diseases susceptibility. 相似文献
14.
15.
Human neonates are highly susceptible to infection, which may be due in part to impaired innate immune function. Neonatal Toll-like receptor (TLR) responses are biased against the generation of pro-inflammatory/Th1-polarizing cytokines, yet the underlying mechanisms are incompletely defined. Here, we demonstrate that neonatal plasma polarizes TLR4-mediated cytokine production. When exposed to cord blood plasma, mononuclear cells (MCs) produced significantly lower TLR4-mediated IL-12p70 and higher IL-10 compared to MC exposed to adult plasma. Suppression by neonatal plasma of TLR4-mediated IL-12p70 production, but not induction of TLR4-mediated IL-10 production, was maintained up to the age of 1 month. Cord blood plasma conferred a similar pattern of MC cytokine responses to TLR3 and TLR8 agonists, demonstrating activity towards both MyD88-dependent and MyD88-independent agonists. The factor causing increased TLR4-mediated IL-10 production by cord blood plasma was heat-labile, lost after protein depletion and independent of lipoprotein binding protein (LBP) or soluble CD14 (sCD14). The factor causing inhibition of TLR4-mediated IL-12p70 production by cord blood plasma was resistant to heat inactivation or protein depletion and was independent of IL-10, vitamin D and prostaglandin E2. In conclusion, human neonatal plasma contains at least two distinct factors that suppress TLR4-mediated IL-12p70 production or induce IL-10 or production. Further identification of these factors will provide insight into the ontogeny of innate immune development and might identify novel targets for the prevention and treatment of neonatal infection. 相似文献
16.
Danielle Burger 《Arthritis research & therapy》2000,2(6):472-5
The intricate interactions that regulate relationships between endogenous tissue cells and infiltrating immune cells in the rheumatic joint, particularly in rheumatoid arthritis (RA), were the subject of the meeting. A better understanding of these interactions might help to define intervention points that could be used to develop specific therapies. The presentations and discussions highlighted the fact that, once chronic inflammation is established, several pro-inflammatory loops involving tumour necrosis factor (TNF)-α and interleukin (IL)-1β can be defined. Direct cellular contact with stimulated T lymphocytes induces TNF-α and IL-1β in monocytes which in turn induce functions in fibroblast-like synoviocytes. The latter include the production of stromal cell-derived factor-1α (SDF-1α) which enhances the expression of CD40L in T cells, which stimulates SDF-1α production in synoviocytes, which in turn protects T and B cells from apoptosis and enhances cell recruitment thus favoring inflammatory processes. IL-1β and TNF-α also induce IL-15 in fibroblast-like synoviocytes, which induces the production of IL-17 which in turn potentiates IL-1β and TNF-α production in monocyte-macrophages. This underlines the importance of TNF-α and IL-1β in RA pathogenesis, and helps explain the efficiency of agents blocking the activity of these cytokines in RA. Factors able to block the induction of cytokine production (such as apolipoprotein A-I [apo A-I] and interferon [IFN]-β) might interfere more distally in the inflammatory process. Furthermore, stimulated T lymphocytes produce osteoclast differentiation factor (ODF), which triggers erosive functions of osteoclasts. Therefore, factors capable of affecting the level of T lymphocyte activation, such as IFN-β, IL-15 antagonist, or SDF-1α antagonist, might be of interest in RA therapy. 相似文献
17.
Ovsyannikova IG Haralambieva IH Vierkant RA Pankratz VS Jacobson RM Poland GA 《Human genetics》2011,130(4):547-561
Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. 相似文献
18.
S. J. D. Vitkus S. A. Hanifin D. W. McGee 《In vitro cellular & developmental biology. Animal》1998,34(8):660-664
Summary Intestinal epithelial cells (IEC) have previously been shown to produce several cytokines including interleukin-6 (IL-6).
However, many factors which may regulate IL-6 secretion by human IEC still remain a mystery due in part to the lack of appropriate
model cell lines and the difficulty of culturing human IEC over long periods of time. We have determined that the human colonic
carcinoma cell line Caco-2 is capable of secreting IL-6 when stimulated by the inflammatory cytokines IL-1β or tumor necrosis
factor-α (TNF-α), and stimulation of these cells with IL-1β plus TNF-α induced a synergistic enhancement of IL-6 secretion.
The inflammatory cytokine-induced enhancement in IL-6 secretion was greatest when the cells were cultured in a 10% CO2 atmosphere as compared to cells grown in 5% CO2, suggesting that environmental CO2 levels may affect IEC cytokine secretion. Finally, long-term culture of the Caco-2 cells to induce cellular differentiation
had no effect on the capacity of these cells to produce IL-6, indicating that the regulation of IL-6 secretion was not affected
by differentiation. Taken together, these studies provide important information on the factors which regulate IL-6 secretion
by human IEC as they may contribute to the cytokine network during a mucosal inflammation. The results also suggest that the
Caco-2 cell line is an appropriate model for further studies on the regulation of cytokine secretion by human IEC. 相似文献
19.
20.
Diverse manifestations of tumorigenicity and immunogenicity displayed by the poorly immunogenic B16-BL6 melanoma transduced with cytokine genes 总被引:4,自引:0,他引:4
Marjorie J. Arca John C. Krauss Scott E. Strome Mark J. Cameron A. E. Chang 《Cancer immunology, immunotherapy : CII》1996,42(4):237-245
We evaluated the in vivo response to the poorly immunogenic B16-BL6 (BL6) murine melanoma genetically altered to secrete
interleukin-2 (IL-2), IL-4, interferon γ (IFNγ) and granulocyte/macrophage-colony-stimulating factor (GM-CSF). Three parameters
were evaluated: (1) tumorigenicity, (2) vaccination of naive animals, and (3) assessment of antitumor reactivity of T cells
derived from tumor-draining lymph nodes (TDLN). Secretion of IL-2 abrogated the tumorigenicity of BL6, while IFNγ and IL-4
partially reduced tumorigenicity, and GM-CSF had no effect. Protective immunity to wild-type tumor challenge could not be
achieved by vaccination with irradiated cytokine-secreting tumors, although IL-2 and IL-4 secretion appeared to retard the
growth of the challenge inoculum significantly. An alternative method to evaluate the immunogenicity of the cytokine-secreting
tumors was to measure the ability of T cells obtained from TDLN to mediate regression of wild-type tumor in adoptive immunotherapy.
Neither IL-2 nor IFNγ secretion resulted in the induction of immune T cells. By contrast, GM-CSF and IL-4 secretion were found
to induce immune T cells in the TDLN with GM-CSF being superior to IL-4. The combined secretion of GM-CSF and IL-4 did not
lead to enhanced induction of immune T cells. GM-CSF secretion was found to up-regulate B7-1 expression in TDLN, consistent
with an increase in the population of antigen-presenting cells. These studies demonstrated that reduced tumorigenicity by
cytokine secretion did not correlate with increased immunogenicity. With the cytokines examined, there was limited capability
of developing protective immunity against the BL6 tumor. Nevertheless, GM-CSF and IL-4 secretion significantly enhanced T
cell immune reactivity to the poorly immunogenic BL6 tumor.
Received: 30 January 1996 / Accepted: 22 March 1996 相似文献