The minute virus of mice capsid specifically recognizes the 3' hairpin structure of the viral replicative-form DNA: mapping of the binding site by hydroxyl radical footprinting.

The terminal hairpin structures of the DNA of minute virus of mice (MVM) are essential for viral replication. Here we show that the hairpin 3' terminus of MVM replicative-form DNA binds specifically to empty MVM capsids. Binding of the same terminal DNA sequence in its linear double-stranded (extended) conformation was not observed. After heat denaturation and quick cooling of 3'-terminal extended-form fragments, not only the virion strand but also the complementary strand was found to bind to the capsid, presumably because each strand re-formed a similar hairpin structure. No binding affinity for the capsid was found to be associated with hairpin or extended 5' termini or with any other region of the viral DNA. Hydroxyl radical footprinting analyses revealed three protected nucleotide stretches forming a binding site at the branch point of the two 3'-terminal hairpin arms looping out from the DNA stem (T structure). Single base changes within this site did not affect the binding. In band shift experiments, specific binding to the T structure was demonstrated for VPI but not for VP2.     

Two spatially distinct genetic elements constitute a bipartite DNA replication origin in the minute virus of mice genome.

Mutations were introduced into plasmid pMM984, a full-length infectious clone of the fibrotropic strain of minute virus of mice, to identify cis-acting genetic elements required for the excision and replication of the viral genome. The replicative capacity of these mutants was measured directly, using an in vivo transient DNA replication assay following transfection of plasmids into murine A9 cells and primate COS-7 cells. Experiments with subgenomic constructs indicated that both viral termini must be present on the same DNA molecule for replication to occur and that the viral nonstructural protein NS-1 must be provided in trans. The necessary sequences were located within 1,084 and 807 nucleotides of the 3' and 5' ends of the minute virus of mice genome, respectively. The inhibitory effect of deletions within the 206-bp 5'-terminal palindrome demonstrated that these sequences comprise a cis-acting genetic element that is absolutely essential for the excision and replication of viral DNA. The results further indicated a requirement for a stem-plus-arms T structure as well as for the formation of a simple hairpin. In addition, the removal of one copy of a tandemly arranged 65-bp repeat found 94 nucleotides inboard of the 5'-terminal palindrome inhibited viral DNA replication in cis by 10- and just greater than 100-fold in A9 and COS-7 cells, respectively. The latter results define a novel genetic element within the 65-bp repeated sequence, distinct from the terminal palindrome, that is capable of regulating minute virus of mice DNA replication in a species-specific manner.     

Multiple cellular factors bind to cis-regulatory elements found inboard of the 5' palindrome of minute virus of mice.

Previous genetic analysis of the DNA replication of minute virus of mice (MVM) minigenomes suggested that specific elements, A (nucleotides [nt] 4489 to 4636) and B (nt 4636 to 4695), found inboard of the 5' palindrome are required for efficient MVM DNA replication (P. Tam and C. R. Astell, Virology 193:812-824, 1993). In this report, we show that two MVM RsaI restriction fragments (RsaI A [nt 4431 to 4579] and RsaI B [nt 4579 to 4662]) are able to activate DNA replication of an MVM minigenome containing deletions of both elements A and B. We also show that sequences inboard of the right palindrome are able to activate replication of minigenomes containing two left termini. In order to investigate the importance of the RsaI fragments, we demonstrate the presence of a number of sequence-specific DNA-protein interactions by electrophoretic mobility shift assays. After partial fractionation of A9 nuclear extracts, DNase I footprinting analysis was used to determine the binding sites for MVM replication factor (MRF) B5. MRF B5 protects two distinct regions (sites I and II) of the RsaI B probe from DNase I digestion. Competition f electrophoretic mobility shift assays with synthetic oligonucleotides corresponding to sites I and II suggest that MRF B5 is composed of two factors, MRF B3 and MRF B4, which bind DNA independently in a sequence-specific manner. It may be possible that these replication factors are proteins which are able to transactivate MVM DNA replication and hence are accessory replication factors.     

Asymmetric resolution of a parvovirus palindrome in vitro.

Cell extracts from murine A9 or human HeLa cells containing wild-type copies the NS1 polypeptide of minute virus of mice (MVM), produced from a recombinant vaccinia virus, can support the resolution of viral 3' termini from palindromic junction fragments of dimeric, replicative-form MVM DNA. Resolution resulted in the generation of two new viral termini, one associated with each arm of the junction palindrome. Telomeres were created in two configurations, "extended" forms, which were covalently associated with NS1 molecules, and smaller "turn-around" forms in which a single arm of the palindrome terminated at the axis of dyad symmetry in a covalent bond which cross-linked the two strands. The in vitro resolution reaction was asymmetric, generating predominantly extended-form termini from one arm of the palindrome but predominantly turn-around forms from the other. This asymmetry was independent of the type of cell used to prepare the in vitro extract or the orientation of the palindrome in the plasmid and was obtained for all cloned junction sequences of 156 bp or more. Two modified forms of the duplex junction fragment, which appeared to be intermediates in the resolution process since they were nicked, covalently linked to NS1, and associated with newly synthesized DNA, were identified. The structures of these intermediates suggest that resolution is initiated by preferential nicking at one of the two candidate resolution sites. The asymmetric nature of this resolution reaction is discussed in terms of current models of MVM DNA replication.     

Analysis of the internal replication sequence indicates that there are three elements required for efficient replication of minute virus of mice minigenomes.

Prior analysis of minigenomes of minute virus of mice carried out by our laboratory indicated that sequences within the region of nucleotides 4489 to 4695, inboard of the 5' palindrome, are required for efficient DNA replication of the virus and are the site of specific interactions with unidentified factors present in a host cell nuclear extract (P. Tam and C. R. Astell, Virology 193:812-824, 1993; P. Tam and C. R. Astell, J. Virology 68:2840-2848, 1994). In order to examine this region in finer detail, a comprehensive library of linker-scanning mutants spanning the region was tested for the ability to support replication of minigenome constructs and for the ability to interact with host cell factors. Three short discrete sequence elements critical for replication competence were observed. Binding of host cell nuclear factors was localized to four sites, with two major complexes each appearing to have two binding sites within the region. All factor binding sites were found to be directly adjacent to or overlapping with sequence elements contributing to replication competence, and evidence suggesting a correlation between factor binding and minigenome replication is presented. A possible model is proposed for function of a viral origin within the region of the internal replication sequence which addresses the still-unresolved problem of how parvoviruses overcome the thermodynamic energy barrier involved in the rearrangement of the 5'-terminal palindrome from an extended form to a hairpin conformation.     

Structure and function of the 3' terminal six nucleotides of the west nile virus genome in viral replication

Using a self-replicating reporting replicon of West Nile (WN) virus, we performed a mutagenesis analysis to define the structure and function of the 3'-terminal 6 nucleotides (nt) (5'-GGAUCU(OH)-3') of the WN virus genome in viral replication. We show that mutations of nucleotide sequence or base pair structure of any of the 3'-terminal 6 nt do not significantly affect viral translation, but exert discrete effects on RNA replication. (i). The flavivirus-conserved terminal 3' U is optimal for WN virus replication. Replacement of the wild-type 3' U with a purine A or G resulted in a substantial reduction in RNA replication, with a complete reversion to the wild-type sequence. In contrast, replacement with a pyrimidine C resulted in a replication level similar to that of the 3' A or G mutants, with only partial reversion. (ii). The flavivirus-conserved 3' penultimate C and two upstream nucleotides (positions 78 and 79), which potentially base pair with the 3'-terminal CU(OH), are absolutely essential for viral replication. (iii). The base pair structures, but not the nucleotide sequences at the 3rd (U) and the 4th (A) positions, are critical for RNA replication. (iv). The nucleotide sequences of the 5th (G) position and its base pair nucleotide (C) are essential for viral replication. (v). Neither the sequence nor the base pair structure of the 6th nucleotide (G) is critical for WN virus replication. These results provide strong functional evidence for the existence of the 3' flavivirus-conserved RNA structure, which may function as contact sites for specific assembly of the replication complex or for efficient initiation of minus-sense RNA synthesis.     

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

Two widely spaced initiator binding sites create an HMG1-dependent parvovirus rolling-hairpin replication origin

Minute virus of mice (MVM) replicates via a linearized form of rolling-circle replication in which the viral nickase, NS1, initiates DNA synthesis by introducing a site-specific nick into either of two distinct origin sequences. In vitro nicking and replication assays with substrates that had deletions or mutations were used to explore the sequences and structural elements essential for activity of one of these origins, located in the right-end (5') viral telomere. This structure contains 248 nucleotides, most-favorably arranged as a simple hairpin with six unpaired bases. However, a pair of opposing NS1 binding sites, located near its outboard end, create a 33-bp palindrome that could potentially assume an alternate cruciform configuration and hence directly bind HMG1, the essential cofactor for this origin. The palindromic nature of this sequence, and thus its ability to fold into a cruciform, was dispensable for origin function, as was the NS1 binding site occupying the inboard arm of the palindrome. In contrast, the NS1 site in the outboard arm was essential for initiation, even though positioned 120 bp from the nick site. The specific sequence of the nick site and an additional NS1 binding site which directly orients NS1 over the initiation site were also essential and delimited the inboard border of the minimal right-end origin. DNase I and hydroxyl radical footprints defined sequences protected by NS1 and suggest that HMG1 allows the NS1 molecules positioned at each end of the origin to interact, creating a distortion characteristic of a double helical loop.     

Specific initiation of replication at the right-end telomere of the closed species of minute virus of mice replicative-form DNA.

We have developed an in vitro system that supports the replication of natural DNA templates of the autonomous parvovirus minute virus of mice (MVM). MVM virion DNA, a single-stranded molecule bracketed by short, terminal, self-complementary sequences, is converted into double-stranded replicative-form (RF) DNA when incubated in mouse A9 fibroblast extract. The 3' end of the newly synthesized complementary strand is ligated to the right-end hairpin of the virion strand, resulting in the formation of a covalently closed RF (cRF) molecule as the major conversion product. cRF DNA is not further replicated in A9 cell extract alone. On addition of purified MVM nonstructural protein NS1 expressed from recombinant baculoviruses or vaccinia viruses, cRF DNA is processed into a right-end (5' end of the virion strand) extended form (5'eRF). This is indicative of NS1-dependent nicking of the right-end hairpin at a distinct position, followed by unfolding of the hairpin and copying of the terminal sequence. In contrast, no resolution of the left-end hairpin can be detected in the presence of NS1. In the course of the right-end nicking reaction, NS1 gets covalently attached to the right-end telomere of the DNA product, as shown by immunoprecipitation with NS1-specific antibodies. The 5'eRF product is the target for additional rounds of NS1-induced nicking and displacement synthesis at the right end, arguing against the requirement of the hairpin structure for recognition of the DNA substrate by NS1. Further processing of the 5'eRF template in vitro leads to the formation of dimeric RF (dRF) DNA in a left-to-left-end configuration, presumably as a result of copying of the whole molecule by displacement synthesis initiated at the right-end telomere. Formation of dRF DNA is highly stimulated by NS1. The experimental results presented in this report support various assumptions of current models of parvovirus DNA replication and provide new insights into the replication functions of the NS1 protein.     

Nucleotide sequences at the terminal of La Crosse virus RNAs.

The 5' and 3'-terminal sequences of the three RNA molecules which make up the genomes of La Crosse virus are reported. Eleven nucleotides at both the 5' and 3' termini of all three RNAs are conserved and complementary. In addition more extensive unique sequence complementarity is present in at least two of the three RNAs.     

Essential Role of Cyclization Sequences in Flavivirus RNA Replication

A possible role in RNA replication for interactions between conserved complementary (cyclization) sequences in the 5'- and 3'-terminal regions of Flavivirus RNA was previously suggested but never tested in vivo. Using the M-fold program for RNA secondary-structure predictions, we examined for the first time the base-pairing interactions between the covalently linked 5' genomic region (first ~160 nucleotides) and the 3' untranslated region (last ~115 nucleotides) for a range of mosquito-borne Flavivirus species. Base-pairing occurred as predicted for the previously proposed conserved cyclization sequences. In order to obtain experimental evidence of the predicted interactions, the putative cyclization sequences (5' or 3') in the replicon RNA of the mosquito-borne Kunjin virus were mutated either separately, to destroy base-pairing, or simultaneously, to restore the complementarity. None of the RNAs with separate mutations in only the 5' or only the 3' cyclization sequences was able to replicate after transfection into BHK cells, while replicon RNA with simultaneous compensatory mutations in both cyclization sequences was replication competent. This was detected by immunofluorescence for expression of the major nonstructural protein NS3 and by Northern blot analysis for amplification and accumulation of replicon RNA. We then used the M-fold program to analyze RNA secondary structure of the covalently linked 5'- and 3'-terminal regions of three tick-borne virus species and identified a previously undescribed additional pair of conserved complementary sequences in locations similar to those of the mosquito-borne species. They base-paired with DeltaG values of approximately -20 kcal, equivalent or greater in stability than those calculated for the originally proposed cyclization sequences. The results show that the base-pairing between 5' and 3' complementary sequences, rather than the nucleotide sequence per se, is essential for the replication of mosquito-borne Kunjin virus RNA and that more than one pair of cyclization sequences might be involved in the replication of the tick-borne Flavivirus species.     

Analysis of the kinetic hairpin transfer model for parvoviral DNA replication

All linear DNA molecules face special problems in replicating their 5' ends, as DNA polymerases add nucleotides only to pre-existing strands with free 3'-OH groups. Parvoviruses, a group of small animal viruses with a linear single-stranded DNA genome, cope with this problem by having palindromic terminal sequences that can fold back on themselves to form hairpin structures essential in priming DNA replication. The 3' terminal sequence that initiates replication becomes reversed in orientation during the process, and if the palindrome is imperfect, two different, reverse-complementary terminal sequences are generated. The relative abundances of the terminal sequence orientations at each end of the DNA molecules can be measured and give information about the replication process. From such clues, we developed a "kinetic hairpin transfer model" based on differential rates of hairpin formation and inversion processes depending on the conformations of the 3' termini. Numerical studies showed that this simple idea can account for the diverse pattern of DNA distributions observed in the family Parvoviridae. In this paper, we simplify the model to a set of coupled linear first-order ordinary differential equations in order to delineate its essential properties by Perron-Frobenius theory. Secondly, we examine our assumption of linear kinetics by modeling enzyme catalysis of the component steps of the hairpin transfer process. We show that the rate-determining step of the process is the binding of initiation complex to the self-priming hairpin structures. Furthermore, we find that if the replication machinery is saturated by DNA substrate late in an infection, the differential equations become non-linear but the steady-state DNA distribution is still given by the solution of our original linear equations.     

Structure of the 3' hairpin termini of four rodent parvovirus genomes: nucleotide sequence homology at origins of DNA replication.

The nucleotide sequences of the 3' termini of the DNA from four autonomous rodent parvoviruses have been determined. The terminus of each genome exists as a Y-shaped hairpin structure involving 115 or 116 nucleotides. The sequence of this region of DNA is highly conserved and shows no evidence of internal sequence heterogeneity, a characteristic which is observed in the terminal nucleotide sequence of the helper-dependent, adeno-associated viruses (Berns et al., 1978a). The implications of these results with respect to the models of parvovirus DNA replication are discussed.     

Sequence analysis of the nicks and termini of bacteriophage T5 DNA.

Bacteriophage T5 DNA, when isolated from mature phage particles, contains several nicks in one of the two strands. The 5'-terminal nucleotides at the nicks were labeled with polynucleotide kinase and [gamma-32P]ATP, and the 3'-terminal nucleotides were labeled with Escherichia coli DNA polymerase I and [alpha-32P]dGTP. The sequences around the nicks were analyzed by partial nuclease digestion followed by homochromatography fractionation of the resulting oligonucleotides. The nicks had at least the sequence -PuOH pGpCpGpC- in common. In addition, the two 5' external termini had the first seven nucleotides in common.