Rapid lysis of vaccinia virus on neutral sucrose gradients with release of intact DNA

A new and improved procedure has been developed for the isolation of intact DNA genomes from purified vaccinia virions. Purified virions are layered on a neutral sucrose gradient containing sodium dodecyl sulfate, 2-mercaptoethanol and sodium chloride at neutral pH. Intact viral DNA free from protein and fully sensitive to DNase I is rapidly released from the virions.     

Restriction enzyme mapping of vaccinia virus DNA.

The cleavage sites for the restriction enzymes Bg/I, HindIII, KpnI, SalI, SmaI, and XhoI were located, from primary data, on the DNA isolated from the WR strain of vaccinia virus. Bg/I and SmaI divide the DNA into five segments which can be isolated by sucrose gradient centrifugation. These large segments provide a convenient means to group segments produced by other enzymes. The construction of physical maps was initiated by identifying the segments at each end of the DNA and then finding segments which were adjacent to these terminal sections. This was accomplished by isolating large shear fragments which contained the covalently linked termini of the DNA. Most of the data needed to derive the maps were obtained by isolating segments produce by one enzyme and then cleaving these individual segments with a second enzyme.     

High-frequency homologous recombination in vaccinia virus DNA.

A recombinant vaccinia virus genome was constructed in which the viral thymidine kinase (tk) gene was placed between direct repeats of a 1.5-kilobase-pair DNA sequence of heterologous origin. When forced to replicate in tk- cells in the presence of methotrexate (i.e., under tk+-selective conditions), the recombinant maintained its tk+ phenotype. Under nonselective conditions, however, the tk gene was frequently excised by both inter- and intramolecular recombination events because the repeated sequences provided substantial targets for homologous DNA recombination. Unique DNA products of intramolecular recombination were detected in the cytoplasm of infected cells soon after the onset of viral DNA replication, and their appearance was blocked by inhibitors of DNA synthesis. During repeated passage of the virus under nonselective conditions, the tk+ fraction decreased with first-order kinetics at a rate that reflected the frequency of recombination per cycle of virus replication. Eventually, a residual population of stable tk+ viruses remained, and analyses of the genome structures of individual members of this population showed that some of them appeared to be the products of nonhomologous DNA recombination.     

Molecular-biological study of vaccinia virus genome. I. Cloning of vaccinia virus DNA fragments in bacterial vectors

The HindIII DNA fragments of vaccinia virus strain L-IVP were cloned in pBR322 bacterial plasmid. A hybrid plasmids collection of pVHn series contains all fragments of virus genome except terminal HindIII-B and HindIII-G, and also a large HindIII-A. The latter was cloned in cosmid pHC79. The obtained collection of hybrid DNA molecules allows to carry out a wide range of molecular biological experiments on the vaccinia virus genome.     

Evidence of a repetitive sequence in vaccinia virus DNA.

Analysis of vaccinia DNA by reassociation kinetics revealed that 7% of the genome contains a sequence repeated 10 times. This sequence does not contain any host cell DNA, is viral specific, and is found in virions passed at either high or low multiplicities of infection.     

Molecular genetic analysis of vaccinia virus DNA polymerase mutants.

To further our understanding of the structure and function of the vaccinia virus DNA polymerase, we have performed fine genetic analysis of three mutants with lesions in the polymerase gene. By performing marker rescue analysis with DNA fragments of decreasing size, each lesion was localized to within 500 base pairs of DNA. The relevant regions of the mutant alleles were then cloned and subjected to DNA sequence analysis, which allowed the assignment of a single nucleotide and amino acid change to each mutant. As well as providing structure-function correlations germane to an understanding of polymerase activity, these data have provided insights into the frequency and possible mechanisms of viral homologous recombination.     

A vaccinia virus DNase preparation which cross-links superhelical DNA.

Multiple DNA-dependent enzyme activities have been detected in highly purified preparations of a single-strand-specific nuclease from vaccinia virus. These enzyme preparations were extensively purified and characterized by using superhelical DNAs as substrates. In particular, the nuclease activity was monitored by the extent of conversion of supercoiled closed duplex DNA (DNA I) to nicked circular DNA (DNA II), which could subsequently be converted to duplex linear DNA (DNA III) by prolonged incubation with the enzyme. DNA species which were not substrates for the enzyme included relaxed closed duplex DNA, DNA II which had been prepared by nuclease S1 treatment or by photochemical nicking of DNA I, and DNA III. With plasmid pSM1 DNA as substrate, the extent of cleavage of DNA I to DNA II was found to increase with superhelix density above a threshold value of about -0.06. The linear reaction products were examined by gel electrophoresis after restriction enzyme digestion of the DNAs from plasmids pSM1 and pBR322 and of the viral DNAs from bacteriophage phi X174 (replicative form) and simian virus 40, and the map coordinate locations of the scissions were determined. These products were further examined by electron microscopy and by gel electrophoresis under denaturing conditions. Electron micrographs taken under partially denaturing conditions revealed molecules with terminal loops or hairpins such as would result from the introduction of cross-links at the cutting sites. These species exhibited snapback renaturation. The denaturing gel electrophoresis experiments revealed the appearance of new bands at locations consistent with terminal cross-linking. With pSM1 and pBR322 DNAs, this band was shown to contain DNA that was approximately twice the length of a linear single strand. The terminal regions of the cross-linked linear duplex reaction products were sensitive to nuclease S1 but insensitive to proteinase K, suggesting that the structure is a hairpin loop not maintained by a protein linker. A similar structure is found in mature vaccinia virus DNA.     

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression.

Vaccinia virus replicates in the cytoplasm of infected cells, generating transient replicative intermediates containing the DNA for the terminal sequences as concatemeric junctions. The processing of the terminal sequences for a series of vaccinia virus conditional lethal mutants at the nonpermissive temperature was analyzed by restriction enzyme digestion and Southern blot hybridization of DNA isolated from infected cells. Three phenotypes were observed: DNA replication negative (Rep-), DNA replication positive but concatemer resolution negative (Rep+ Res-), and DNA replication positive and concatemer resolution positive (Rep+ Res+). Interestingly, all six Rep+ Res- mutants from separate complementation groups were defective in late protein synthesis. Isatin beta-thiosemicarbazone, a drug that blocks late protein synthesis, also prevented resolution of concatemers. Orthogonal field gel electrophoresis of the DNA generated by the late defective mutants revealed a distribution of linear genome multimers. The multimers were processed into mature monomers after a shift to the permissive temperature in the presence of cytosine arabinoside for all the Rep+ Res- mutants except ts22, an irreversible mutant which cleaves RNA late in infection (R.F. Pacha and R.C. Condit, J. Virol. 56:395-403, 1985). Genome formation can be divided into two stages: DNA replication, which generates concatemers, and resolution, which processes concatemers into monomers with hairpin termini. Early viral genes are required for the former, and late viral genes are required for the latter.     

Inverted terminal repeats in rabbit poxvirus and vaccinia virus DNA.

In both rabbit poxvirus and vaccinia virus DNA have demonstrated an identical distribution of eight HinfI. The length of the terminal repeats was found to be 3.4 to 3.6 megadaltons (Mdaltons) for rabbit poxvirus DNA and 7.4 to 8.0 Mdaltons for vaccinia virus DNA. Maps of the HinfI restriction sites within isolated EcoRI end fragments of rabbit poxvirus and vaccinia virus DNA PHAVE DEMONSTRATED AN IDENTICAL DISTRIBUTION OF EIGHT HinfI sites in an internal part (approximately 2 Mdaltons) of the EcoRI end fragments of the two genomes.     

Restriction enzyme digests of rapidly renaturing fragments of vaccinia virus DNA.

Vaccinia virus DNA fragments that have been denatured by alkali and then neutralized contain a fraction that rapidly reforms duplex structures. The fraction is enriched by fractionating on hydroxyapatite columns and serves as as substrate for digestion by two restriction endonucleases isolated from Hemophilus parainfluenzae, Hpa I and HPa II. The patterns obtained by gel electrophoresis of the digested fragments show the presence of three major bands after Hpa I digestion and four major bands after Hpa II digestion. The DNA that is isolated from some of these bands quickly reforms duplex regions after alkaline denaturation. The size of the DNA segments in the major bands has been estimated to be in the range of 0.44 X 10(6) to 3.2 X 10(6) daltons. The fragments which rapidly reform duplex chains after denaturation are sensitive to single-strand-specific nucleases. These results are consistent with a model of vaccinia virus DNA which has a covalent link connecting complementary chains.     

Simultaneous purification of RNA-dependent DNA polymerase and gs-antigen from Rauscher leukemia virus.

RNA-dependent DNA polymerase and gs-antigen were purified simultaneously from Rauscher leukemia virus by sequential column chromatography on phosphocellulose. The partially purified RNA-dependent DNA polymerase has a molecular weight of 70,000 and is free of cellular DNA polymerase, deoxynucleotidyl terminal transferase, RNase and DNase. The partially purified RNA-dependent DNA polymerase can efficiently copy oligo dT·poly rA and oligo dG·poly rC. The purified gs-antigen shows a single band on SDS-polyacrylamide gel with a molecular weight of 30,000. It is active immunologically and possesses both group and interspecies activity.     

Evaluation of a method for high yield purification of largely intact mitochondrial DNA from human placentae

We developed, and quantitatively and qualitatively evaluated an easily reproducible method for high yield purification of mitochondrial DNA (mtDNA) from human placentae by mechanical tissue disruption, differential centrifugation of mitochondria, enzymatic digestion, phenol extraction and ethanol precipitation. Average mtDNA yields were 2.5 microg/g tissue (without an RNAse treatment step) and 1.5 microg/g tissue (with an RNAse treatment step). This mtDNA migrated as a 16.5-kb isolated band in agarose gels; it yielded fragments of expected sizes after digestion with restriction enzymes; it successfully served as a template in long PCR for amplification of mtDNA sequences, and hybridized to an mtDNA probe in a predictable fashion. MtDNA yields of this method were 10-fold higher than those of previously reported ones for mtDNA purification from freshly obtained human cells and tissues, with the advantage that more placental tissue can be obtained for mtDNA purification than other types of tissue, at lower cost, and with minimal or no ethical issues.     

Comparative restriction analysis of HindIII-F-fragments of DNA from 4 strains of vaccinia virus

The localization of KpnI, SacI, XhoI, AvaI, PstI, BglI, BamHI, EcoRI, PmiI, SalI, BglII, restriction endonuclease cleavage sites in HindIII-F-fragments of DNA from vaccinia strains WR, Copenhagen, LIVP and neurovaccine has been detected. The fragments have been shown to differ in the number of AvaI, EcoRI and BamHI sites. The fragments also differ from the analogue of Tian Tan vaccinia strain in the pattern of restriction by AvaI, XhoI, PstI, EcoRI and BamHI endonucleases.     

ATM protein purified from vaccinia virus expression system: DNA binding requirements for kinase activation

The ataxia-telangiectasia mutated (ATM) gene product plays a role in responding to double stand DNA breaks. Some biochemical studies of ATM function have been hampered by lack of an efficient expression system and abundant purified ATM protein. We report the construction of a vaccinia virus expressing ATM, vWR-ATM, which was used to produce large amounts of functional FLAG-tagged ATM protein (FLAG-ATM) in HeLa cells. Kinase activity of the purified FLAG-ATM was dependent on manganese and inhibited with wortmannin. Using the FLAG-ATM recombinant protein, GST-p53 serine 15 phosphorylation increased in the presence of damaged DNA. PHAS-1 phosphorylation was found to be DNA independent. Purified FLAG-ATM was recovered in the autophosphorylated form, as demonstrated by phosphorylation of ATM serine 1981. As shown by atomic force microscopy, FLAG-ATM bound to linear DNA both at broken ends and in mid-strands. Vaccinia virus is the most efficient ATM expression system described to date.