Estrogen receptor alpha interaction with estrogen response element half-sites from the rat prolactin gene

Estrogen regulation of the rat prolactin gene requires sequences within the DNase I hypersensitive site II (HSII). We have used overexpressed mouse estrogen receptor alpha (ERalpha) protein to study interactions of ERalpha with an imperfect estrogen response element (ERE) and four ERE half-site sequences from HSII. We confirmed that ERalpha has higher affinity for ERE half-sites than for the imperfect ERE. As expected, the imperfect ERE formed a complex with ERalpha similar to that between mERalpha and a consensus ERE in gel shift assays. The ERalpha complex with half-sites, however, had faster mobility on a 4% polyacrylamide gel than the ERalpha complex with a consensus ERE, indicating that the complexes had different compositions. Ferguson analysis revealed that the ERalpha/half-site complex had a larger molecular weight and higher negative charge than the ERalpha/consensus ERE complex. Similar results were observed with purified human ERalpha, showing that the ERalpha/half-site complex contained only ERalpha and oligonucleotides. These results are best explained by a model in which a dimer of ERalpha is bound to two half-site oligonucleotides. We propose that two ERalpha dimers may interact with the four ERE half-sites in HSII to influence estrogen regulation of this gene.     

Mineralocorticoid receptor gene expression in the gastrointestinal tract: distribution and ontogeny

The gastrointestinal tract is a well characterized target tissue for aldosterone, where it regulates electrolyte transport, particularly in the descending colon. Previous studies have demonstrated the presence of aldosterone receptors in gastrointestinal tissues. We have used specific cRNA probes for the rat mineralocorticoid receptor to explore both the distribution and ontogeny of mineralocorticoid receptor gene expression in the gastrointestinal tract. Mineralocorticoid receptor gene expression is found throughout the small and large intestine, but is absent from the stomach. The highest levels are observed in the distal colon, and significant expression is found in the duodenum; in both tissues levels of expression are higher than those in kidney. In both the developing duodenum and colon, mineralocorticoid receptor gene expression precedes the development of the full physiological response to aldosterone. These findings emphasise the colon as an important target tissue for aldosterone, and raise the question of potential roles for aldosterone in the duodenum.     

Polarity of the ecdysone receptor complex interaction with the palindromic response element from the hsp27 gene promoter.

The functional 20-hydroxyecdysone (20E) receptor is a heterodimer of two members of the nuclear hormone receptors superfamily; the product of the EcR (EcR) and of the ultraspiracle (Usp) genes. As most of the natural 20E-response elements are highly degenerated palindromes, we were interested in determining whether or not such asymmetric elements could dictate the defined orientation of the Usp/EcR complex. We have investigated interaction of EcR and Usp DNA-binding domains (EcRDBD and UspDBD, respectively) with the palindromic response element from the hsp27 gene promoter (hsp27pal). The hsp27pal half-sites contribute differently to the binding of the heterodimer components; the 5' half-site exhibits higher affinity for both DBDs than the 3' half-site. This observation, along with data demonstrating that UspDBD exhibits approximate fourfold higher affinity to the 5' half-site than EcRDBD, suggest that UspDBD locates the EcRDBD/UspDBD heterocomplex in the defined orientation (5'-UspDBD-EcRDBD-3') on the hsp27pal sequence. The binding polarity onto hsp27pal is accompanied by different contribution of the UspDBD and EcRDBD C-terminal sequences to the DNA-binding and heterocomplex formation. This is supported by finding that deletion of the C-terminal of EcRDBD region corresponding to the putative A-helix severely decreased binding of the EcRDBD to the hsp27pal. In contrast, UspDBD in which corresponding residues were deleted exhibited the same hsp27pal binding pattern as the wild type UspDBD. Additional truncation comprising the putative T-box, resulted in a reduced binding of the mutated UspDBD. This truncation however, still allowed effective EcRDBD/UspDBD heterodimer formation. Finally we demonstrated that perfect palindromes, composed of two hsp27pal 5' half-sites (or of the related sequence) contain all of the structural information necessary for the anisotropic UspDBD/EcRDBD heterocomplex formation. However, the perfect palindromes bind isolated homomeric DBDs as well as their heterocomplex with higher affinity than imperfect hsp27pal. This is the first report indicating that natural 20E response elements, which with one exception are degenerated palindromes, may act as functionally asymmetric elements in a manner similar to the action of direct repeats in vertebrates.     

Assembly of a glucocorticoid receptor complex prior to DNA binding enhances its specific interaction with a glucocorticoid response element

Gel retardation analysis with full- and half-palindromic sequences using partially purified glucocorticoid receptor (GR) resulted in GR-glucocorticoid response element (GRE) species of identical mobilities, suggesting that formation of the dimeric GR protein complex is not catalyzed by DNA binding. These results are in contrast to the behavior of the isolated DNA binding domain of the glucocorticoid receptor where dimerization occurred on the GRE. Density gradient centrifugation of cytosolic GR resulted in two forms, a 4 S peak characteristic of the monomeric GR and a fraction which sediments at 6 S which is consistent with the observed size of the dimeric GR. These two forms were found to differ in their ability to bind to specific DNA sequences with the 6 S species having a higher affinity for a GRE. Taken together our results are consistent with a two-step model for hormone-induced transformation of GR: dissociation of the multimeric untransformed complex and dimerization of the GR to yield a high affinity DNA binding species.     

A new thermostable proteinase from Thermoactinomyces SP.27a. Cloning and gene expression

A library of Thermoactinomyces sp. 27a, producer of thermostable proteases of different groups, has been created. Gene coding for thermostable neutral proteinase was cloned and expressed in Bac. subtilis cells. Restriction map for cloned DNA fragment was created and physicochemical parameters of recombinant proteinase were characterized. The thermostability and optimum of proteolytic activity of the enzyme was lower than in the natural Thermoactinomyces sp. strain, which can be due to heterologous expression of the gene coding for thermostable protein in the mesophilic host.     

Identification of a Vitamin D response element in the human insulin receptor gene promoter

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.