Deuterium isotope effects on the central carbon metabolism of Escherichia coli cells grown on a D2O-containing minimal medium

In this paper it is demonstrated that cross-correlated time modulation of isotropic chemical shifts (`conformational exchange') leads to differential relaxation of double- and zero-quantum coherences, respectively. Quantitative information can be obtained from the time dependence of the interconversion between the two two-spin coherences 2I_xS_x and 2I_yS_y, induced by the differential relaxation. The effect is illustrated with an application to ¹³C,¹⁵N-labeled quail CRP2(LIM2), by studying ¹⁵N-¹H^N multiple-quantum relaxation. Significant cross-correlated fluctuations of isotropic chemical shifts were observed for residues which are part of a disordered loop region connecting two -strands in CRP2(LIM2). Differential ¹H^N and ¹⁵N exchange contributions to multiple-quantum relaxation observed at these sites illustrate the complex interplay between hydrogen bonding events and conformational reorientations in proteins.     

Backbone dynamics of the oligomerization domain of p53 determined from 15N NMR relaxation measurements.

The backbone dynamics of the tetrameric p53 oligomerization domain (residues 319-360) have been investigated by two-dimensional inverse detected heteronuclear 1H-15N NMR spectroscopy at 500 and 600 MHz. 15N T1, T2, and heteronuclear NOEs were measured for 39 of 40 non-proline backbone NH vectors at both field strengths. The overall correlation time for the tetramer, calculated from the T1/T2 ratios, was found to be 14.8 ns at 35 degrees C. The correlation times and amplitudes of the internal motions were extracted from the relaxation data using the model-free formalism (Lipari G, Szabo A, 1982, J Am Chem Soc 104:4546-4559). The internal dynamics of the structural core of the p53 oligomerization domain are uniform and fairly rigid, with residues 327-354 exhibiting an average generalized order parameter (S2) of 0.88 +/- 0.08. The N- and C-termini exhibit substantial mobility and are unstructured in the solution structure of p53. Residues located at the N- and C-termini, in the beta-sheet, in the turn between the alpha-helix and beta-sheet, and at the C-terminal end of the alpha-helix display two distinct internal motions that are faster than the overall correlation time. Fast internal motions (< or = 20 ps) are within the extreme narrowing limit and are of uniform amplitude. The slower motions (0.6-2.2 ns) are outside the extreme narrowing limit and vary in amplitude.(ABSTRACT TRUNCATED AT 250 WORDS)     

Off-resonance rotating-frame amide proton spin relaxation experiments measuring microsecond chemical exchange in proteins

NMR spin relaxation in the rotating frame (R_1ρ) is a unique method for atomic-resolution characterization of conformational (chemical) exchange processes occurring on the microsecond time scale. Here, we use amide ¹H off-resonance R_1ρ relaxation experiments to determine exchange parameters for processes that are significantly faster than those that can be probed using ¹⁵N or ¹³C relaxation. The new pulse sequence is validated using the E140Q mutant of the C-terminal domain of calmodulin, which exhibits significant conformational exchange contributions to the transverse relaxation rates. The ¹H off-resonance R_1ρ data sample the entire relaxation dispersion profiles for the large majority of residues in this protein, which exchanges between conformations with a time constant of approximately 20 μs. This is in contrast to the case for ¹⁵N, where additional laboratory-frame relaxation data are required to determine the exchange parameters reliably. Experiments were performed on uniformly ¹⁵N-enriched samples that were either highly enriched in ²H or fully protonated. In the latter case, dipolar cross-relaxation with aliphatic protons were effectively decoupled to first order using a selective inversion pulse. Deuterated and protonated samples gave the same results, within experimental errors. The use of deuterated samples increases the sensitivity towards exchange contributions to the ¹H transverse relaxation rates, since dipolar relaxation is greatly reduced. The exchange correlation times determined from the present ¹H off-resonance R_1ρ experiments are in excellent agreement with those determined previously using a combination of ¹⁵N laboratory-frame and off-resonance R_1ρ relaxation data, with average values of and 21 ± 3 μs, respectively.     

CPMG sequences with enhanced sensitivity to chemical exchange

Improved relaxation-compensated Carr–Purcell–Meiboom-Gill pulse sequences are reported for studying chemical exchange of backbone ¹⁵N nuclei. In contrast to the original methods [J. P. Loria, M. Rance, and A. G. Palmer, J. Am. Chem. Soc. 121, 2331–2332 (1999)], phenomenological relaxation rate constants obtained using the new sequences do not contain contributions from ¹H-¹H dipole-dipole interactions. Consequently, detection and quantification of chemical exchange processes are facilitated because the relaxation rate constant in the limit of fast pulsing can be obtained independently from conventional ¹⁵N spin relaxation measurements. The advantages of the experiments are demonstrated using basic pancreatic trypsin inhibitor.     

NMR detection of multiple transitions to low-populated states in azurin

Transitions to conformational states with very low populations were detected for the reduced blue copper protein azurin from Pseudomonas aeruginosa by applying constant relaxation time CPMG measurements to the backbone (15)N nuclei at three magnetic fields (11.7, 14.1, and 18.8 T) and three temperatures (25.7, 35.4, and 44.8 degrees C). Two exchange processes with different rate constants could be discriminated despite populations of the excited states below 1% and spatial neighborhood of the two processes. The group of (15)N nuclei involved in the faster process exhibits at 44.8 degrees C a forward rate constant of 11.7+/-2.4 s(-1) and a population of the exited state of 0.39+/-0.07%. They surround the aromatic ring of histidine 35 whose protonation state is coupled to the flipping of a neighboring peptide plane. For the slower process, the forward rate constant and population of the exited state at 44.8 degrees C are 4.1+/-0.1 s(-1) and 0.45+/-0.02%, respectively. The residues involved cluster nearby the copper ion, which is separated from the protonation site of histidine 35 by about 8 A, indicating conformational rearrangements involving the copper coordinating loops. The dependence of the equilibrium constant on the temperature is consistent with an enthalpy-dominated transition around the copper, but an entropy-controlled transition near histidine 35. The detection by nuclear magnetic resonance of millisecond to second conformational transitions near the copper ion suggests a low energy-cost rearrangement of the copper-binding site that may be necessary for efficient electron transfer.     

Measurement of 15N relaxation in the detergent-solubilized tetrameric KcsA potassium channel

A set of TROSY-HNCO (tHNCO)-based 3D experiments is presented for measuring ¹⁵N relaxation parameters in large, membrane-associated proteins, characterized by slow tumbling times and significant spectral overlap. Measurement of backbone ¹⁵N R ₁, R _1ρ, ¹⁵N–{¹H} NOE, and ¹⁵N CSA/dipolar cross correlation is demonstrated and applied to study the dynamic behavior of the homotetrameric KcsA potassium channel in SDS micelles under conditions where this channel is in the closed state. The micelle-encapsulated transmembrane domain, KcsA^TM, exhibits a high degree of order, tumbling as an oblate ellipsoid with a global rotational correlation time, τ_c = 38 ± 2.5 ns, at 50 °C and a diffusion anisotropy, , corresponding to an aspect ratio a/b ≥ 1.4. The N- and C-terminal intracellular segments of KcsA exhibit considerable internal dynamics (S ² values in the 0.2–0.45 range), but are distinctly more ordered than what has been observed for unstructured random coils. Relaxation behavior in these domains confirms the position of the C-terminal helix, and indicates that in SDS micelles, this amphiphilic helix does not associate into a stable homotetrameric helical bundle. The relaxation data indicate the absence of elevated backbone dynamics on the ps–ns time scale for the 5-residue selectivity filter, which selects K⁺ ions to enter the channel. Electronic Supplementary Material Supplementary material is available to authorised users in the online version of this article at . An erratum to this article can be found at     

Off-resonance rf fields in heteronuclear NMR: Application to the study of slow motions

The advantages of using off-resonance rf fields in heteronuclear self-relaxation experiments are explored on a fully ¹⁵N-enriched protein. It is firstly shown that in the absence of slow motions the longitudinal and transverse ¹⁵N self-relaxation rate values derived with this method are in agreement with the ones measured by the classical inversion-recovery and Carr–Purcell–Meiboom–Gill (CPMG) sequences, respectively. Secondly, by comparing the ¹⁵N transverse self-relaxation rates obtained by the proposed off-resonance sequence and by the CPMG sequence, 11 residues out of the 61 of toxin are shown to exhibit a chemical exchange phenomenon in water on a time scale ranging from 1 µs to 100 ms. By varying the effective field amplitude, chemical exchange processes involving these residues are measured and the corresponding correlation times are evaluated without having assumed any motion model. Similar, though less precise, results are given by the analysis of the ¹⁵N off-resonance self-relaxation rates on the basis of the Lipari–Szabo model to describe the fast internal dynamics of toxin .     

15N backbone dynamics of the S-peptide from ribonuclease A in its free and S-protein bound forms: toward a site-specific analysis of entropy changes upon folding.

Backbone 15N relaxation parameters (R1, R2, 1H-15N NOE) have been measured for a 22-residue recombinant variant of the S-peptide in its free and S-protein bound forms. NMR relaxation data were analyzed using the "model-free" approach (Lipari & Szabo, 1982). Order parameters obtained from "model-free" simulations were used to calculate 1H-15N bond vector entropies using a recently described method (Yang & Kay, 1996), in which the form of the probability density function for bond vector fluctuations is derived from a diffusion-in-a-cone motional model. The average change in 1H-15N bond vector entropies for residues T3-S15, which become ordered upon binding of the S-peptide to the S-protein, is -12.6+/-1.4 J/mol.residue.K. 15N relaxation data suggest a gradient of decreasing entropy values moving from the termini toward the center of the free peptide. The difference between the entropies of the terminal and central residues is about -12 J/mol residue K, a value comparable to that of the average entropy change per residue upon complex formation. Similar entropy gradients are evident in NMR relaxation studies of other denatured proteins. Taken together, these observations suggest denatured proteins may contain entropic contributions from non-local interactions. Consequently, calculations that model the entropy of a residue in a denatured protein as that of a residue in a di- or tri-peptide, might over-estimate the magnitude of entropy changes upon folding.     

Phosphorus-31 Transverse Relaxation Rate Measurements by NMR Spectroscopy: Insight into Conformational Exchange Along the Nucleic Acid Backbone

Phosphorus ((31)P) NMR spectroscopy can provide important information about the dynamics of nucleic acids. In this communication, we propose an inversely detected (31)P transverse relaxation rate ( R (2)) measurement experiment. This experiment enables fast measurement of accurate (31)P transverse relaxation rates and provides the possibility to detect slow motions mapped by the phosphorus nuclei along the nucleic acid backbone. Dispersion curves show some (31)P nuclei experiencing chemical exchange in the millisecond time scale. Under the assumption of a two-state exchange process, the reduced lifetimes of the exchanging sites (tau(ex)) obtained are in accordance with base pair lifetime estimates deduced from imino proton exchange measurements.     

Backbone dynamics of the human CC chemokine eotaxin: fast motions, slow motions, and implications for receptor binding.

Eotaxin is a member of the chemokine family of about 40 proteins that induce cell migration. Eotaxin binds the CC chemokine receptor CCR3 that is highly expressed by eosinophils, and it is considered important in the pathology of chronic respiratory disorders such as asthma. The high resolution structure of eotaxin is known. The 74 amino acid protein has two disulfide bridges and shows a typical chemokine fold comprised of a core of three antiparallel beta-strands and an overlying alpha-helix. In this paper, we report the backbone dynamics of eotaxin determined through 15N-T1, T2, and [1H]-15N nuclear Overhauser effect heteronuclear multidimensional NMR experiments. This is the first extensive study of the dynamics of a chemokine derived from 600, 500, and 300 MHz NMR field strengths. From the T1, T2, and NOE relaxation data, parameters that describe the internal motions of eotaxin were derived using the Lipari-Szabo model free analysis. The most ordered regions of the protein correspond to the known secondary structure elements. However, surrounding the core, the regions known to be functionally important in chemokines show a range of motions on varying timescales. These include extensive subnanosecond to picosecond motions in the N-terminus, C-terminus, and the N-loop succeeding the disulfides. Analysis of rotational diffusion anisotropy of eotaxin and chemical exchange terms at multiple fields also allowed the confident identification of slow conformational exchange through the "30s" loop, disulfides, and adjacent residues. In addition, we show that these motions may be attenuated in the dimeric form of a synthetic eotaxin. The structure and dynamical basis for eotaxin receptor binding is discussed in light of the dynamics data.     

NMR investigation of the dynamics of tryptophan side-chains in hemoglobins

NMR relaxation measurements of 15N spin-lattice relaxation rate (R(1)), spin-spin relaxation rate (R(2)), and heteronuclear nuclear Overhauser effect (NOE) have been carried out at 11.7T and 14.1T as a function of temperature for the side-chains of the tryptophan residues of 15N-labeled and/or (2H,15N)-labeled recombinant human normal adult hemoglobin (Hb A) and three recombinant mutant hemoglobins, rHb Kempsey (betaD99N), rHb (alphaY42D/betaD99N), and rHb (alphaV96W), in the carbonmonoxy and the deoxy forms as well as in the presence and in the absence of an allosteric effector, inositol hexaphosphate (IHP). There are three Trp residues (alpha14, beta15, and beta37) in Hb A for each alphabeta dimer. These Trp residues are located in important regions of the Hb molecule, i.e. alpha14Trp and beta15Trp are located in the alpha(1)beta(1) subunit interface and beta37Trp is located in the alpha(1)beta(2) subunit interface. The relaxation experiments show that amino acid substitutions in the alpha(1)beta(2) subunit interface can alter the dynamics of beta37Trp. The transverse relaxation rate (R(2)) for beta37Trp can serve as a marker for the dynamics of the alpha(1)beta(2) subunit interface. The relaxation parameters of deoxy-rHb Kemspey (betaD99N), which is a naturally occurring abnormal human hemoglobin with high oxygen affinity and very low cooperativity, are quite different from those of deoxy-Hb A, even in the presence of IHP. The relaxation parameters for rHb (alphaY42D/betaD99N), which is a compensatory mutant of rHb Kempsey, are more similar to those of Hb A. In addition, TROSY-CPMG experiments have been used to investigate conformational exchange in the Trp residues of Hb A and the three mutant rHbs. Experimental results indicate that the side-chain of beta37Trp is involved in a relatively slow conformational exchange on the micro- to millisecond time-scale under certain experimental conditions. The present results provide new dynamic insights into the structure-function relationship in hemoglobin.     

15N relaxation study of the cold shock protein CspB at various solvent viscosities

For a detailed NMR study of the dynamics of the cold shock protein CspB from Bacillus subtilis, we determined ¹⁵N transverse and longitudinal relaxation rates and heteronuclear nuclear Overhauser effects at different solvent viscosities. Up to a relative viscosity of 2, which is equivalent to 27% ethylene glycol (EG), the overall correlation time follows the linear Stokes-Einstein equation. At a relative viscosity of 6 (70% EG) the correlation time deviates from linearity by 30%, indicating that CspB tumbles at a higher rate as expected from the solvent viscosity probably due to a preferential binding of water molecules at the protein surface. The corresponding hydrodynamic radii, determined by NMR diffusion experiments, show no variation with viscosity. The amplitudes of intramolecular motions on a sub-nanosecond time scale revealed by an extended Lipari–Szabo analysis were mainly independent of the solvent viscosity. The lower limit of the NMR `observation window' for the internal correlation time shifts above 0.5 ns at 70% EG, which is directly reflected in the experimentally derived internal correlation times. Chemical exchange contributions to the transverse relaxation rates derived from the Lipari-Szabo approach coincide with the experimentally determined values from the transverse ¹H-¹⁵N dipolar/¹⁵N chemical shift anisotropy relaxation interference. These contributions originate from fast protein folding reactions on a millisecond timescale, which get retarded at increased solvent viscosities.     

Probing multiple effects on 15N, 13C alpha, 13C beta,and 13C' chemical shifts in peptides using density functional theory

We have used density functional calculations on model peptides to study conformational effects on (15)N, (13)C alpha, (13)C beta, and (13)C' chemical shifts, associated with hydrogen bonding, backbone conformation, and side-chain orientation. The results show a significant dependence on the backbone torsion angles of the nearest three residues. Contributions to (15)N chemical shifts from hydrogen bonding (up to 8 ppm), backbone conformation (up to 13 ppm), side-chain orientation and neighborhood residue effects (up to 22 ppm) are significant, and a unified theory will be required to account for their behavior in proteins. In contrast to this, the dependence on sequence and hydrogen bonding is much less for (13)C alpha and (13)C beta chemical shifts (<0.5 ppm), and moderate for carbonyl carbon shifts (<2 ppm). The effects of side-chain orientation are mainly limited to the residue itself for both nitrogen and carbon, but the chi(1) effect is also significant for the nitrogen shift of the following residue and for the (13)C' shift of the preceding residue. The calculated results are used, in conjunction with an additive model of chemical shift contributions, to create an algorithm for prediction of (15)N and (13)C shifts in proteins from their structure; this includes a model to extrapolate results to regions of torsion angle space that have not been explicitly studied by density functional theory (DFT) calculations. Crystal structures of 20 proteins with measured shifts have been used to test the prediction scheme. Root mean square deviations between calculated and experimental shifts 2.71, 1.22, 1.31, and 1.28 ppm for N, C alpha, C beta, and C', respectively. This prediction algorithm should be helpful in NMR assignment, crystal and solution structure comparison, and structure refinement.     

Inherent backbone dynamics fine-tune the functional plasticity of Tudor domains

1. Download : Download high-res image (162KB)
2. Download : Download full-size image

     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence. Correspondence to: A. N. Lane     

The use of TROSY for detection and suppression of conformational exchange NMR line broadening in biological macromolecules

The interference between conformational exchange-induced time-dependent variations of chemical shifts in a pair of scalar coupled ¹H and ¹⁵N spins is used to construct novel TROSY-type NMR experiments to suppress NMR signal loss in [¹⁵N,¹H]-correlation spectra of a 14-mer DNA duplex free in solution and complexed with the Antp homeodomain. An analysis of double- and zero-quantum relaxation rates of base ¹H–¹⁵N moieties showed that for certain residues the contribution of conformational exchange-induced transverse relaxation might represent a dominant relaxation mechanism, which, in turn, can be effectively suppressed by TROSY. The use of the new TROSY method for exchange-induced transverse relaxation optimization is illustrated with two new experiments, 2D ^h1 J _HN,^h2 J _NN-quantitative [¹⁵N,¹H]-TROSY to measure ^h1 J _HN and ^h2 J _NN scalar coupling constants across hydrogen bonds in nucleic acids, and 2D (^h2 J _NN+^h1 J _NH)-correlation-[¹⁵N,¹H]-TROSY to correlate ¹H^N chemical shifts of bases with the chemical shifts of the tertiary ¹⁵N spins across hydrogen bonds using the sum of the trans-hydrogen bond coupling constants in nucleic acids.     

Backbone dynamics of free barnase and its complex with barstar determined by 15N NMR relaxation study

Backbone dynamics of uniformly ¹⁵N-labeled free barnase and its complex with unlabelled barstar have been studied at 40°C, pH 6.6, using ¹⁵N relaxation data obtained from proton-detected 2D {¹H}-¹⁵N NMR spectroscopy. ¹⁵N spin-lattice relaxation rate constants (R₁), spin-spin relaxation rate constants (R₂), and steady-state heteronuclear {¹H}-¹⁵N NOEs have been measured at a magnetic field strength of 14.1 Tesla for 91 residues of free barnase and for 90 residues out of a total of 106 in the complex (excluding three prolines and the N-terminal residue) backbone amide ¹⁵N sites of barnase. The primary relaxation data for both the cases have been analyzed in the framework of the model-free formalism using both isotropic and axially symmetric models of the rotational diffusion tensor. As per the latter, the overall rotational correlation times (_m) are 5.0 and 9.5 ns for the free and complexed barnase, respectively. The average order parameter is found to be 0.80 for free barnase and 0.86 for the complex. However, the changes are not uniform along the backbone and for about 5 residues near the binding interface there is actually a significant decrease in the order parameters on complex formation. These residues are not involved in the actual binding. For the residues where the order parameter increases, the magnitudes vary significantly. It is observed that the complex has much less internal mobility, compared to free barnase. From the changes in the order parameters, the entropic contribution of NH bond vector motion to the free energy of complex formation has been calculated. It is apparent that these motions cause significant unfavorable contributions and therefore must be compensated by many other favorable contributions to effect tight complex formation. The observed variations in the motion and their different locations with regard to the binding interface may have important implications for remote effects and regulation of the enzyme action.     

Gated electron transfers and electron pathways in azurin: a NMR dynamic study at multiple fields and temperatures

Dynamic properties of electron transfer pathways in a small blue copper cupredoxin are explored using an extensive 15N NMR relaxation study of reduced Pseudomonas aeruginosa azurin at four magnetic fields (500-900 MHz) and at two temperatures chosen well below the melting point of the protein. Following a careful model-free analysis, several protein regions with different dynamic regimes are identified. Nanosecond time-scale mobility characterizes various residues of the hydrophobic surface patch believed to mark the natural entry point for electrons, notably the surface-exposed copper-ligand His117. These findings are consistent with a gated electron transfer process according to the "dynamic docking" model. Residues 47-49 along intramolecular pathways of electrons show rigidity that is remarkably conserved when increasing the temperature. Three different conformational exchange processes were observed in the millisecond range, one near the only disulfide bridge in the molecule and two near the copper ion. The latter two processes are consistent with previous data such as crystal structures at various pH values and NMR relaxation dispersion experiments; they may indicate an additional gated electron transfer mechanism at slower time-scales.     

Temperature-dependent spectral density analysis applied to monitoring backbone dynamics of major urinary protein-I complexed with the pheromone 2-sec-butyl-4,5-dihydrothiazole*

Backbone dynamics of mouse major urinary protein I (MUP-I) was studied by (15)N NMR relaxation. Data were collected at multiple temperatures for a complex of MUP-I with its natural pheromonal ligand, 2- sec -4,5-dihydrothiazole, and for the free protein. The measured relaxation rates were analyzed using the reduced spectral density mapping. Graphical analysis of the spectral density values provided an unbiased qualitative picture of the internal motions. Varying temperature greatly increased the range of analyzed spectral density values and therefore improved reliability of the analysis. Quantitative parameters describing the dynamics on picosecond to nanosecond time scale were obtained using a novel method of simultaneous data fitting at multiple temperatures. Both methods showed that the backbone flexibility on the fast time scale is slightly increased upon pheromone binding, in accordance with the previously reported results. Zero-frequency spectral density values revealed conformational changes on the microsecond to millisecond time scale. Measurements at different temperatures allowed to monitor temperature dependence of the motional parameters.