Simultaneous electroelution and concentration of DNA fragments from agarose gels

A rapid and inexpensive method for the electroelution of DNA fragments from agarose gels is described. DNA fragments were separated by agarose gel electrophoresis and visualized by staining with ethidium bromide. Selected DNA fragments were placed into electroeluter tubes capped with dialysis membrane and electroeluted into a small volume of buffer using a conventional horizontal gel electrophoresis apparatus. The method successfully eluted and concentrated DNA fragments with molecular weights ranging from 2.7 to 13.9 MDa in 3 h.     

Micronuclear DNA from Paramecium tetraurelia: serotype 51 A gene has internally eliminated sequences.

A method for the isolation of micronuclear DNA from Paramecium tetraurelia has been developed. After cell lysis, a low speed centrifugation at 1,000 g is used to remove all of the unbroken cells and macronuclei and approximately two thirds of the macronuclear fragments. Next a higher speed centrifugation of 9,000 g sediments the micronuclei and frees them from small particulates and soluble constituents. Advantage is then taken of the fact that micronuclei have a lower density than do macronuclear fragments in 45%-60% Percoll. Micronuclei float to the top during centrifugation at 24,000 g, while macronuclear fragments sediment. After several cycles of centrifugation in Percoll, the micronuclei, although heavily contaminated with cytoplasmic components, are essentially free of macronuclei and macronuclear fragments. Micronuclear DNA can then be extracted from the suspension. The whole procedure is very rapid and in about an hour micronuclear and macronuclear DNA can be separated. About 2 micrograms of micronuclear DNA can be obtained from 6 x 10(7) paramecia. We find that there are internal sequences in the micronuclear A gene DNA in wild type cells which are eliminated when the micronuclei develop into macronuclei. They yield unique restriction fragments for micronuclei and macronuclei. Therefore the purity of the preparations is easily monitored by probing Southern blots of restriction enzyme-digested DNA with the cloned A gene. No differences have been found between the micronuclear A gene in wild type and the d48 mutant.     

A protocol for DNA fragment extraction from polyacrylamide gels

A simple and efficient method of purifying linear plasmid DNA from contaminating DNA fragments is described. Both vector and insert containing plasmids may be used without extensive purification, in particular without cesium chloride centrifugation. Careful deproteinization with phenol-chloroform allows efficient restriction enzyme digestion. Fragment separation can be performed immediately after restriction endonuclease digestion in a single 6% polyacrylamide gel. Extraction of DNA fragments from the gel is easy and gives a good yield. The DNA may be used for ligation and transformation without further purification.     

Manipulation of a Large DNA Molecule using the Phase Transition

A conventional method of DNA sequencing can determine up to 1000 base pairs at one time. Therefore, long DNA should be cut into many short fragments that are suitable for DNA sequencing. Those fragments, however, lose their order information. If the fragments are prepared from the terminus of the long DNA, the reorganization process can be omitted. This process consists of following unit operations; manipulation of genomic DNA, fixation with a stretched form, cutting from the terminus, recovery and amplification. In these unit operations, manipulation and cutting of DNA are focused in this report. Globular transformation suppresses break down of long genome DNA and permits manipulation of large DNA. Because globular transition is reversible, the coiled DNA can be sequentially spun from the globular DNA like a spindle. Thespun DNA was successfully fixed on a glass surface in an arbitrary pattern. To prepare fragments from the stretched DNA molecule, a method to cut DNA moleculen was developed. Since most restriction enzyme requires magnesium ion for their activation, the restriction enzyme was successfully activated only when magnesium ion was electrochemically supplied.     

Large-scale isolation of covalently closed circular DNA using gel filtration chromatography

The isolation of covalently closed circular (ccc) DNA free of contamination by RNA and other forms of DNA is fundamental to molecular biology. A variety of methods have been explored but CsCl density-gradient centrifugation remains the method most widely used for preparative scale resolution. The process is expensive, time-consuming, requires the use of large amounts of the carcinogen ethidium bromide, and is subject to considerable variation in yield and purity. To avoid these problems, we have devised a procedure for the preparation of cell lysates which results in consistently good yields of biologically active ccc DNA minimally contaminated with chromosomal DNA fragments and RNA. Lysates are deproteinized, precipitated with CaCl2 to remove rRNA, concentrated by ethanol precipitation, and applied to a Sephacryl S-1000 column which resolves chromosomal fragments, open circular plasmid DNA, and residual RNA from the ccc DNA. We have found that substituting the gel filtration column for CsCl density-gradient centrifugation results in substantially better purification as well as reducing processing time, cost, and degree of difficulty. The time required from harvest of cells to final recovery of DNA is about 16 h. We have used the method to isolate plasmids from 4.4 to 12 kb and, with slight modifications, recombinant M13 replicative form DNAs.     

Micronuclear DNA from Paramecium tetraurelia: Serotype 51 A Gene Has Internally Eliminated Sequences

A method for the isolation of micronuclear DNA from Paramecium tetraurelia has been developed. After cell lysis, a low speed centrifugation at 1,000 g is used to remove all of the unbroken cells and macronuclei and approximately two thirds of the macronuclear fragments. Next a higher speed centrifugation of 9,000 g sediments the micronuclei and frees them from small particulates and soluble constituents. Advantage is then taken of the fact that micronuclei have a lower density than do macronuclear fragments in 45%–60% Percoll. Micronuclei float to the top during centrifugation at 24,000 g , while macronuclear fragments sediment. After several cycles of centrifugation in Percoll, the micronuclei, although heavily contaminated with cytoplasmic components, are essentially free of macronuclei and macronuclear fragments. Micronuclear DNA can then be extracted from the suspension. The whole procedure is very rapid and in about an hour micronuclear and macronuclear DNA can be separated. About 2 μ g of micronuclear DNA can be obtained from 6 times 10⁷ paramecia. We find that there are internal sequences in the micronuclear A gene DNA in wild type cells which are eliminated when the micronuclei develop into macronuclei. They yield unique restriction fragments for micronuclei and macronuclei. Therefore the purity of the preparations is easily monitored by probing Southern blots of restriction enzyme-digested DNA with the cloned A gene. No differences have been found between the micronuclear A gene in wild type and the d48 mutant.     

Northern blot mapping: a procedure for mapping mRNA immobilized on nitrocellulose by probing with end-labeled DNA fragments

A simple method for mapping RNA on a Northern blot with a mixture of end-labeled DNA fragments is described. The DNA fragments are labeled either in 5' or in 3' directly after digestion by restriction enzyme(s) and used without any further purification step as probe to hybridize a Northern blot. After autoradiography, the DNA fragments hybridized to each mRNA species are recovered by heating the nitrocellulose and analyzed on denaturing polyacrylamide or agarose gels. This method indicates which DNA fragment hybridizes with which mRNA species and requires far fewer different manipulations than successive hybridization of a Northern blot with several nick-translated purified DNA fragments.     

Rapid DNA fingerprinting of pathogens by flow cytometry

BACKGROUND: A new method for rapid discrimination among bacterial strains based on DNA fragment sizing by flow cytometry is presented. This revolutionary approach combines the reproducibility and reliability of restriction fragment length polymorphism (RFLP) analysis with the speed and sensitivity of flow cytometry. METHODS: Bacterial genomic DNA was isolated and digested with a rare-cutting restriction endonuclease. The resulting fragments were stained stoichiometrically with PicoGreen dye and introduced into an ultrasensitive flow cytometer. A histogram of burst sizes from the restriction fragments (linearly related to fragment length in base pairs) resulted in a DNA fingerprint that was used to distinguish among different bacterial strains. RESULTS: Five different strains of gram-negative Escherichia coli and six different strains of gram-positive Staphylococcus aureus were distinguished by analyzing their restriction fragments with DNA fragment sizing by flow cytometry. Fragment distribution analyses of extracted DNA were approximately 100 times faster and approximately 200,000 times more sensitive than pulsed-field gel electrophoresis (PFGE). When sample preparation time is included, the total DNA fragment analysis time was approximately 8 h by flow cytometry and approximately 24 h by PFGE. CONCLUSIONS: DNA fragment sizing by flow cytometry is a fast and reliable technique that can be applied to the discrimination among species and strains of human pathogens. Unlike some polymerase chain reaction (PCR)-based methods, sequence information about the bacterial strains is not required, allowing the detection of unknown, newly emerged, or unanticipated strains.     

Construction and application of a modified “gene machine”: A circular concentrating preparative gel electrophoresis device employing discontinuous elution

A modified version of a preparative circular gel electrophoresis apparatus, first described by Edwin Southern (Medical Research Council, University of Edinburgh, Edinburgh, Scotland), has been constructed. The apparatus fractionates a large volume of sample into concentric bands which migrate toward a small circular collection chamber. Samples exiting the gel into the collection chamber are concentrated against a dialysis membrane which encloses the inner electrode and are pumped from this center chamber into a fraction collector at fixed time intervals. The apparatus has been employed to fractionate samples of DNA (10 mg) by electrophoresis through either agarose or acrylamide gels. Two examples of nucleic acids which have been successfully fractionated are given: restriction endonuclease cleavage fragments of total soybean DNA, and a heterogeneous mixture of covalently closed circular plasmid DNA from Bacillus megaterium. Franctionated DNA is suitable for molecular cloning directly from acrylamide and, after one additional treatment, from agarose. The run time for DNA treated with restriction endonuclease is from 24 to 48 h. Purification of 60- to 200-fold is common for a DNA restriction fragment from a total genome.     

Silver staining of DNA restriction fragments for the ultrarapid identification of pseudorabies virus strains.

Restriction endonuclease analysis of pseudorabies virus DNA has been used to study various virus strains. To make use of a rapid technique for the identification of viral strains, studies have been undertaken to facilitate purification of the DNA from viral particles present in cytoplasmic fractions. The ultrasensitive photochemical silver staining of nucleic acid, described by Beidler et al. (Analytic Biochemistry 1982: 126) has been adapted and applied to the detection of pseudorabies virus restriction fragments. In a period of 5 h more than 1 microgram of DNA can be extracted from a 25 cm2 plastic flask containing infected cells and purified without ultra centrifugation. Low molecular weight DNA was separated from high molecular weight DNA by polyacrylamide gel electrophoresis. The restriction fragments were selectively visualized by silver staining which can detect 0.025 micrograms of total pseudorabies virus DNA. The electrophoretic DNA pattern of vaccine and wild strains has been studied using these techniques and the results agree with previously published data.     

Multiple bandshift assay: rapid identification and cloning of DNA fragments containing specific protein-binding sites

A new rapid method for the identification and cloning of DNA fragments containing specific protein-binding domains is based on the common bandshift assay. Cloned DNA is digested with a restriction endonuclease recognizing a particular 4-bp sequence, an aliquot of this digest is end-labelled and used in protein binding reactions with and without protein extract. The binding reactions are then loaded onto nondenaturing polyacrylamide gel. The main portion of the digest is run in a parallel lane and serves as a source of fragments for cloning. Autoradiography of the wet gel reveals loss in intensity of some bands from the restriction digest incubated with the protein extract. DNA fragments corresponding to these bands are cut out from the gel; DNA is eluted and cloned in the M13 vector, thus allowing rapid and simple sequencing of the inserts.

The method, terned multiple bandshift assay, is especially useful when screening relatively long DNA fragments (of several kb) for potential protein-binding domains. The procedure was used to study interaction of HeLa-cell nuclear proteins with a 5.2-kb downstream region of pseudorabies virus immediate-early gene ( . Vl ek, Z. Kozmik, V. Pa es, S. Schirm and M. Schwyzer, unpublished).     

Restriction mapping of recombinant lambda DNA molecules using pulsed field gel electrophoresis

We have integrated pulsed field gel electrophoresis with the partial digestion strategy of Smith and Birnstiel (1976, Nucleic Acids Res. 3,2387-2398) to generate a rapid and accurate method of restriction endonuclease mapping recombinant lambda DNA molecules. Use of pulsed field gels dramatically improves the accuracy of size determination and resolution of DNA restriction fragments relative to standard agarose gels. Briefly, DNA is partially digested with restriction enzymes to varying extents and then hybridized with a radiolabeled oligonucleotide which anneals specifically to one of the lambda cohesive (cos) ends, effectively end labeling only those digestion products containing that cos end. In this study, we have used an oligonucleotide hybridizing to the right cos end. DNA is then fractionated by pulsed field gel electrophoresis, the gel dried down, and cos end containing fragments visualized by autoradiography. Fragment sizes indicate the distances from the labeled cos end to each restriction site for the particular restriction enzyme employed. This procedure requires only minimal quantities of DNA and is applicable to all vectors utilizing lambda cos ends.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

Rapid isolation of animal mitochondrial DNA by alkaline extraction

A simple technique for rapid isolation of mitochondrial DNA (mtDNA) from animal cells is described. The method is based on the selective alkaline denaturation procedure of Birnboim and Doly [(1979) Nucleic Acids Res. 7, 1513-1523] and avoids the use of CsCl gradient centrifugation. The yield of mtDNA is comparable to that obtained by standard techniques. This DNA is sufficiently pure for restriction analysis and cloning of mtDNA fragments.     

A simple method for isolation of DNA fragments associated with the nuclear lamina in vivo

We describe a simple method for the purification of DNA fragments associated with the nuclear lamina in vivo. Ehrlich ascite tumor cells are first u.v.-irradiated to crosslink DNA to proteins. The nuclear lamina is then isolated and purified by low-speed centrifugation through a cushion of 40% sucrose. The material sedimenting through the created density barrier represents nuclear lamina of a very high purity, free from any DNA fragments except those which were in a crosslinking distance to it in vivo.     

Development of a fluorophore-ribosomal DNA restriction typing method for monitoring structural shifts of microbial communities

DNA restriction fragment polymorphism technologies such as amplified ribosomal DNA restriction analysis (ARDRA) and terminal restriction fragment length polymorphism (T-RFLP) have been widely used in investigating microbial community structures. However, these methods are limited due to either the low resolution or sensitivity. In this study, a fluorophore-ribosomal DNA restriction typing (f-DRT) approach is developed for structural profiling of microbial communities. 16S rRNA genes are amplified from the community DNA and digested by a single restriction enzyme Msp I. All restriction fragments are end-labeled with a fluorescent nucleotide Cy5-dCTP via a one-step extension reaction and detected with an automated DNA sequencer. All 50 predicted restriction fragments between 100 and 600 bp were detected when twelve single 16S rRNA gene sequences were analyzed using f-DRT approach; 92% of these fragments were determined with accuracy of ±2 bp. In the defined model communities containing five components with different ratios, relative abundance of each component was correctly revealed by this method. The f-DRT analysis also showed structural shifts of intestinal microbiota in carcinogen-treated rats during the formation of precancerous lesions in the colon, as sensitive as multiple digestion-based T-RFLP analysis. This study provides a labor and cost-saving new method for monitoring structural shifts of microbial communities.     

Restriction endonuclease cleavage of satellite DNA in intact bovine nuclei

We have analyzed the efficiency with which specific nucleotide sequences within nucleosomes are recognized and cleaved by DNA restriction endonucleases. A system amenable to this sort of analysis is the cleavage of the bovine genome with the restriction endonuclease EcoRI. Bovine satellite I comprises 7% of the genome and is tandemly repetitious with an EcoRI site at 1400 base pair (bp) intervals within this sequence. The ease with which this restriction fragment can be measured permits an analysis of the accessibility of this sequence when organized in a nucleosomal array.Initial studies indicated that satellite I sequences are organized in a nucleosomal structure in a manner analogous to that observed for total genomic DNA. We then examined the accessibility of the EcoRI cleavage sites in satellite to endonucleolytic cleavage in intact nuclei. We find that whereas virtually all the satellite I sequences from naked DNA are cleaved into discrete 1400 bp fragments, only 33% of the satellite I DNA is liberated as this fragment from intact nuclei. These data indicate that 57% of the EcoRI sites in nuclei are accessible to cleavage and that cleavage can occur within the core of at least half the nucleosomal subunits. Analysis of the products of digestion suggests a random distribution of nucleosomes about the EcoRI sites of satellite I DNA.Finally, the observation that satellite sequences can be cleaved from nuclei to 1400 bp length fragments with their associated proteins provides a method for the isolation of specific sequences as chromatin. Using sucrose gradient velocity centrifugation, we have isolated a 70% pure fraction of satellite I chromatin. Nuclease digestion of this chromatin fraction reveals the presence of nucleosomal subunits and indicates that specific sequences can be isolated in this manner without gross disorganization of their subunit structure.     

A simple and efficient procedure for the isolation of high-quality phage lambda DNA using a DEAE-cellulose column

A simple and rapid procedure for purifying large quantities of bacteriophage lambda particles and DNA is described. The procedure involves DEAE-cellulose column chromatography of the phage particles and elution of the phage particles from the column with a low-ionic-strength buffer. The resulting phage were well separated from RNA, DNA, and proteins derived from Escherichia coli host cells. The lambda DNA was prepared from the purified phage particles by the conventional method of phenol extraction and ethanol precipitation. This procedure did not use nucleases, proteases, detergents, or CsCl density gradient centrifugation. The lambda DNA obtained by this method was equivalent in purity to the material prepared by CsCl density gradient centrifugation and amenable to restriction enzyme digestion, ligation, radiolabeling, and double-stranded DNA sequencing. A detailed protocol is described for obtaining 0.5 to 1.0 mg DNA from a 1-liter liquid lysate in less than 5 h. This procedure is simple, inexpensive, and timesaving, and is particularly suitable for large-scale isolation of lambda DNA.     

Rapid isolation of high-molecular-weight DNA from agarose gels

We have developed a simple, reliable, and rapid method for recovering DNA from agarose gels. While many methods for DNA extraction have already been described, few provide quantitative recovery of large DNA molecules. These procedures generally require costly apparatus, extended elution times, or considerable handling of the sample after elution. Our method employs a novel electroelution chamber constructed from acrylic plastic. Gel slices containing DNA are placed in the chamber between platinum electrodes. Voltage is applied and a continuous flow of buffer sweeps the eluted DNA from the chamber into an external receptacle. Elution is complete in 7 min. Concentrated DNA is obtained by butanol extraction and alcohol precipitation in 1 h. Recoveries, quantitated by counting radiolabeled DNA or by densitometry of analytical gels, were 94 to 100% for fragments of 4 to 50 kb. The eluted DNA was undegraded and could be digested with restriction enzymes, ligated, end-labeled, or used to transform cells as efficiently as noneluted DNA. Complete elution of a 100-kb plasmid, a 194-kb concatemer of bacteriophage lambda, and of 440- and 550- chromosomes of Saccharomyces cerevisiae was also achieved using the same process. This method is suitable for routine use in a wide range of cloning applications, including the electrophoretic isolation of large DNA molecules.     

Use of DNA-protein interaction to isolate specific genomic DNA sequences.

We describe a simple and rapid method for the isolation of specific genomic DNA sequences recognized by DNA-binding proteins. This procedure consists of four steps: (1) restriction enzyme digestion and size fractionation of genomic DNA; (2) DNA--protein binding using the gel mobility-shift assay; (3) ligation of isolated DNA fragments followed by transformation of Escherichia coli; and (4) screening of recombinant clones for inserts containing specific DNA--protein binding sequences. We have used this protocol to isolate human DNA sequences, 100-200 bp in size, that are recognized by both partially purified and affinity purified proteins. Unlike other procedures designed to identify genomic target sequences, the method described does not require polymerase chain reaction or successive immunoprecipitations.