Involvement of the Yeast DNA Polymerase δ in DNA Repair in Vivo

The POL3 encoded catalytic subunit of DNA polymerase δ possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24°, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase δ. SDP5 is most probably the p55 subunit of Polδ of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair.     

The DNA–DNA spacing in gemini surfactants–DOPE–DNA complexes

Gemini surfactants from the homologous series of alkane-α,ω-diyl-bis(dodecyldimethylammonium bromide) (CnCS12, number of spacer carbons n = 2 – 12) and dioleoylphosphatidylethanolamine (DOPE) were used for cationic liposome (CL) preparation. CLs condense highly polymerized DNA creating complexes. Small-angle X-ray diffraction identified them as condensed lamellar phase L_α^C in the studied range of molar ratios CnGS12/DOPE in the temperature range 20 – 60 °C. The DNA–DNA distance (d_DNA) is studied in dependence to CnGS12 spacer length and membrane surface charge density. The high membrane surface charge densities (CnGS12/DOPE = 0.35 and 0.4 mol/mol) lead to the linear dependence of d_DNA vs. n correlating with the interfacial area of the CnGS12 molecule.     

Recombination in human mitochondrial DNA?

The possibility of recombination in human mitochondrial DNA (mtDNA) has been hotly debated over the last few years. In this study, a general model of recombination in circular molecules is developed and applied to a recently published African sample (n = 21) of complete mtDNA sequences. It is shown that the power of correlation measures to detect recombination in circular molecules can be vanishingly small and that the data are consistent with the given model and no recombination only if the overall heterogeneity in mutation rate is <0.09.     

Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase

Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with k_cat ≈ 8 x 10⁻³ s⁻¹ and K_M < 1 nM at 25°C under conditions where T4 DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower k_cat and a K_M ≈ 300 nM. The rate of ligation increased with addition of Mn²⁺, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (<100 µM) and pH >8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA.     

The in situ formation of DNA · DNA duplexes of Drosophila virilis satellite DNA

The DNA of Drosophila virilis brains and imaginal discs was labeled in vitro to a specific activity of 6 X 10(-5) dpm/mug, using an organ culture medium. The DNA was fractionated on neutral and alkaline CsC1 gradients and the heavy strands of satellite I annealed in situ to denatured polytene chromosomes from squash preparations of larval salivary glands. Nuclease S1 from Aspergillus oryzae was used to digest the unpaired ssDNA, resulting in a distinct labeling of the alpha-heterochromatin in the chromocenter and a small amount of diffused labeling in the proximal beta-heterochromatic part of the X-Chromsome.     

DNA intercalation without flipping in the specific ThaI–DNA complex

The PD-(D/E)XK type II restriction endonuclease ThaI cuts the target sequence CG/CG with blunt ends. Here, we report the 1.3 Å resolution structure of the enzyme in complex with substrate DNA and a sodium or calcium ion taking the place of a catalytic magnesium ion. The structure identifies Glu54, Asp82 and Lys93 as the active site residues. This agrees with earlier bioinformatic predictions and implies that the PD and (D/E)XK motifs in the sequence are incidental. DNA recognition is very unusual: the two Met47 residues of the ThaI dimer intercalate symmetrically into the CG steps of the target sequence. They approach the DNA from the minor groove side and penetrate the base stack entirely. The DNA accommodates the intercalating residues without nucleotide flipping by a doubling of the CG step rise to twice its usual value, which is accompanied by drastic unwinding. Displacement of the Met47 side chains from the base pair midlines toward the downstream CG steps leads to large and compensating tilts of the first and second CG steps. DNA intercalation by ThaI is unlike intercalation by HincII, HinP1I or proteins that bend or repair DNA.     

D-loop mutations in mitochondrial DNA: link with mitochondrial DNA depletion?

Clinical presentation of the patients with mitochondrial DNA depletion is quite diverse and is suggestive of genetic heterogeneity. Autosomal recessive inheritance of the disease appears likely, thus implying the nuclear origin of the disease. This has been demonstrated recently in large families with neonatal presentation of the disease. Here, we report upon a family with one child having a late-onset disease associated with severe mitochondrial DNA depletion. The presence of mitochondrial alterations in the muscle of the patient's mother prompted us to extensively analyse the mitochondrial DNA in the family. We found mitochondrial DNA multiple deletions, but also three heteroplasmic point mutations of the D-loop region, two of which (T119C and T408A) affect conserved regions involved in the mtDNA replication process. These mutations were non-randomly distributed in the maternal lineage and, for one of them, among single muscle fibres. Involvement of the mitochondrial DNA in its own depletion appears therefore possible. It may act in close relationship with a hypothetical modified nuclear factor.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

DNA structure: cations in charge?

Recent X-ray diffraction, NMR spectroscopy and molecular mechanics results suggest that monovalent cations selectively partition into the minor groove of AT-tracts in DNA. These observations are consistent with DNA deformation by electrostatic collapse around areas of uneven cation density. This model predicts the occurrence of known DNA deformations, such as AT-tract bending and changes in the minor-groove width.     

Conditional Mutations in the Yeast DNA Primase Genes Affect Different Aspects of DNA Metabolism and Interactions in the DNA Polymerase α-Primase Complex

Different pri1 and pri2 conditional mutants of Saccharomyces cerevisiae altered, respectively, in the small (p48) and large (p58) subunits of DNA primase, show an enhanced rate of both mitotic intrachromosomal recombination and spontaneous mutation, to an extent which is correlated with the severity of their defects in cell growth and DNA synthesis. These effects might be attributable to the formation of nicked and gapped DNA molecules that are substrates for recombination and error-prone repair, due to defective DNA replication in the primase mutants. Furthermore, pri1 and pri2 mutations inhibit sporulation and affect spore viability, with the unsporulated mutant cells arresting with a single nucleus, suggesting that DNA primase plays a critical role during meiosis. The observation that all possible pairwise combinations of two pri1 and two pri2 alleles are lethal provides further evidence for direct interaction of the primase subunits in vivo. Immunopurification and immunoprecipitation studies on wild-type and mutant strains suggest that the small subunit has a major role in determining primase activity, whereas the large subunit directly interacts with DNA polymerase α, and either mediates or stabilizes association of the p48 polypeptide in the DNA polymerase α-primase complex.