Electron microscopic study of the repressor of bacteriophage λ and its interaction with operator DNA

The structure of purified phage λ repressor has been examined by high resolution electron microscopy. The repressor molecule appears predominantly as a tetramer of about 95 Å × 120 Å. We have proposed a model to account for the variety of aspects seen on the electron micrographs. Spreading DNA without protein film and use of uranyl formate staining allowed the simultaneous visualization of the DNA and the structure of the repressor molecule bound to it. Mapping the positions of λ repressor bound to whole λ DNA shows preferential binding to the region containing the operators. At high resolution multiple binding of repressor to the operator can be demonstrated. Depending on the amount of repressor present, rows of one to four repressor tetramers are seen on the DNA, confirming the model of the operator containing four binding sites for repressor. The bound repressor can consequently protect against nuclease digestion of operator pieces of approximately 30, 57, 87 and 111 base-pairs. The isolated operator appears in the electron microscope as short double-stranded DNA fragments which can be shown to rebind repressor.     

Homologous interactions of λ repressor and λ Cro with the λ operator

Lambda repressor and lambda Cro bind to the same six sites on the phage chromosome but with different relative affinities. Nucleotides at certain positions in the operator are conserved in all sites, as are amino acids at certain positions in the recognition α-helices of repressor and Cro. Here we focus on one of the conserved amino acids, a serine found at position 2 of each recognition helix. We show that, contrary to a previous model, both serines contact the same conserved position in the operator, position 4. We suggest a simplified view of how repressor and Cro recognize similar operator sites but distinguish differently among them.     

Computer simulation of the interaction of α3hclix of λ Cro protein with DNA and origin of sequence specific recognition

The conformation of the α3 helix of Cro protein (residues 27–36) of bacteriophageλ is optimised by the damped least square minimization technique, with the steric constraint that Cα atom positions should match the crystallographic data available to date. On the basis of minimization of total interaction and conformation energy, models for complexes of this peptide sequence with heptanucleotide duplexes from native and altered O_R3 operator are obtained in the major groove of B DNA. Analysis of the energetics for 3 sequences of the DNA show that binding strength is derived mainly from the interaction of side chains of the peptide with DNA. Sequence specificity (maximum difference in binding energy for different DNA sequences) is due to hydrogen bonding interaction. A small amount of sequence specificity is derived from non-bonded interaction also. Stereochemical aspects of peptide DNA interaction and their role in DNA recognition are discussed in this paper.     

OR3 operator of bacteriophage λ in a 23 base-pair DNA fragment: Sequence-specific 1H NMR assignments for the non-labile protons and comparison with the isolated 17 base-pair operator

Sequence-specific ¹H NMR assignments are presented for a non-selfcomplementary 23-base-pair DNA duplex of molecular weight 15,000 daltons, containing the O_R3 repressor binding site of bacteriophage as the central core. The NMR techniques used were mainly phase-sensitive two-dimensional NOE and 2Q spectroscopy, the latter to overcome overlap problems within the spectral region of the deoxyribose spin-systems. Direct sequential NOE connectivities are observed between adenine 2H and deoxyribose 1 protons. We propose the use of these connectivities as a check of the assignments of C1 and A2 protons, which have independently been derived via other assignment pathways.Abbreviation COSY 2-dimensional correlated spectroscopy - NOESY 2-dimensional nuclear-Overhauser-enhancement spectroscopy - RELAYED-COSY 2-dimensional relayed coherence transfer spectroscopy - 2Q two-quantum - ppm parts per million - 23-bp DNA d-(ATCTATCACCGCAAGGGATAAAT) · d-(ATTTATCCCTTGCGGTGATAGAT) - 17-bp DNA (O_R3) d-(TATCACCGCAAGGGATA) · d-(TATCCCTTGCGGTGATA) - d_i(X;Y) intra-residue distance between protons X and Y - d_s(X;Y) sequential distance between protons X and Y located in sequentially neighbouring nucleotides, where the direction from X to Y is always from 5 to 3     

ClpP/ClpX-mediated degradation of the bacteriophage λ O protein and regulation of λ phage and λ plasmid replication

The O protein is a replication initiator that binds to the orilambda region and promotes assembly of the bacteriophage lambda replication complex. This protein, although protected from proteases by other elements of the replication complex, in a free form is rapidly degraded in the host, Escherichia coli, by the ClpP/ClpX protease. Nevertheless, the physiological role of this rapid degradation remains unclear. Here we demonstrate that the copy number of plasmids derived from bacteriophage lambda is significantly higher in wild-type cells growing in rich media than in slowly growing bacteria. However, lambda plasmid copy number in bacteria devoid of the ClpP/ClpX protease was not dependent on the bacterial growth rate and in all minimal media tested was comparable to that observed in wildtype cells growing in a rich medium. Contrary to lambda plasmid replication, the efficiency of lytic growth of bacteriophage lambda was found to be dependent on the host growth rate in both wild-type bacteria and clpP and clpX mutants. The activities of two major lambda promoters operating during the lytic development, p(R) and p(L), were found to be slightly dependent on the host growth rate. However, when p(R) activity was significantly decreased in the dnaA mutant, production of phage progeny was completely abolished at low growth rates. These results indicate that the O protein (whose level in E. coli cells depends on the activity of ClpP/ClpX protease) is a major limiting factor in the regulation of lambda plasmid replication at low bacterial growth rates. However, this protein seems to be only one of the limiting factors in the bacteriophage lambda lytic development under poor growth conditions of host cells. Therefore, it seems that the role of the rapid ClpP/ClpX-mediated proteolysis of the O protein is to decrease the efficiency of early DNA replication of the phage in slowly growing host cells.     

Revisiting the NMR structure of the ultrafast downhill folding protein gpW from bacteriophage λ

GpW is a 68-residue protein from bacteriophage λ that participates in virus head morphogenesis. Previous NMR studies revealed a novel α+β fold for this protein. Recent experiments have shown that gpW folds in microseconds by crossing a marginal free energy barrier (i.e., downhill folding). These features make gpW a highly desirable target for further experimental and computational folding studies. As a step in that direction, we have re-determined the high-resolution structure of gpW by multidimensional NMR on a construct that eliminates the purification tags and unstructured C-terminal tail present in the prior study. In contrast to the previous work, we have obtained a full manual assignment and calculated the structure using only unambiguous distance restraints. This new structure confirms the α+β topology, but reveals important differences in tertiary packing. Namely, the two α-helices are rotated along their main axis to form a leucine zipper. The β-hairpin is orthogonal to the helical interface rather than parallel, displaying most tertiary contacts through strand 1. There also are differences in secondary structure: longer and less curved helices and a hairpin that now shows the typical right-hand twist. Molecular dynamics simulations starting from both gpW structures, and calculations with CS-Rosetta, all converge to our gpW structure. This confirms that the original structure has strange tertiary packing and strained secondary structure. A comparison of NMR datasets suggests that the problems were mainly caused by incomplete chemical shift assignments, mistakes in NOE assignment and the inclusion of ambiguous distance restraints during the automated procedure used in the original study. The new gpW corrects these problems, providing the appropriate structural reference for future work. Furthermore, our results are a cautionary tale against the inclusion of ambiguous experimental information in the determination of protein structures.     

Advances in the study of protein–DNA interaction

Protein-DNA interaction plays an important role in many biological processes. The classical methods and the novel technologies advanced have been developed for the interaction of protein-DNA. Recent developments of these methods and research achievements have been reviewed in this paper.     

NMR study of short β(1-3)-glucans provides insights into the structure and interaction with Dectin-1

β(1-3)-Glucans, abundant in fungi, have the potential to activate the innate immune response against various pathogens. Although part of the action is exerted through the C-type lectin-like receptor Dectin-1, details of the interaction mechanism with respect to glucan chain-length remain unclear. In this study, we investigated a set of short β(1-3)-glucans with varying degree of polymerization (DP); 3, 6, 7, 16, and laminarin (average DP; 25), analyzing the relationship between the structure and interaction with the C-type lectin-like domain (CTLD) of Dectin-1. The interaction of short β(1-3)-glucans (DP6, DP16, and laminarin) with the CTLD of Dectin-1 was systematically analyzed by ¹H-NMR titration as well as by saturation transfer difference (STD)-NMR. The domain interacted weakly with DP6, moderately with DP16 and strongly with laminarin, the latter plausibly forming oligomeric protein-laminarin complexes. To obtain structural insights of short β(1-3)-glucans, the exchange rates of hydroxy protons were analyzed by deuterium induced ¹³C-NMR isotope shifts. The hydroxy proton at C4 of laminarin has slower exchange with the solvent than those of DP7 and DP16, suggesting that laminarin has a secondary structure. Diffusion ordered spectroscopy revealed that none of the short β(1-3)-glucans including laminarin forms a double or triple helix in water. Insights into the interaction of the short β(1-3)-glucans with Dectin-1 CTLD provide a basis to understand the molecular mechanisms of β-glucan recognition and cellular activation by Dectin-1.     

Structural basis of protein–protein interaction studied by NMR

This paper describes efforts of the structural genomics project in the nuclear magnetic resonance (NMR) laboratory at the University of Science and Technology of China. This structural genomics project is biological-functional driven. Targets are mainly selected from two systems: proteins related with regulation of gene expression in humans and other eukaryotes, and proteins existing in the cell junction in humans. The majority of proteins selected from these two systems are related with human health and diseases, and some are potential drug targets. Twenty-five protein structures from Homo sapiens and other eukaryotes have been determined during last 5 years in this laboratory. Nuclear magnetic resonance (NMR) spectroscopy is highly suited to investigate molecular interactions at a close physiological condition and is particularly suited for the study of low-affinity, transient complexes. It can provide information on protein surface interaction, their complex structure, and their dynamic properties during protein recognition. Several examples are given in this paper.     

Effects on protein structure and function of replacing tryptophan with 5-hydroxytryptophan: Single-tryptophan mutants of the N-terminal domain of the bacteriophage λ repressor

Conformational energy computations have been carried out on the N-acetyl-N′-methylamide of 5-hydroxytryptophan (5OH-Trp) using ECEPP/3. As observed with tryptophan (Trp), the most preferred conformation about theC ^α ?C ^β bond of the side chain isg ⁺ ort. This preference is reduced to only thet conformational state when 5-hydroxyTrp is in the middle of a right-handed poly(l-alanine)α-helix. A similar result has been obtained with Trp [Pielaet al. (1987),Biopolymers 1987, 1273–1286]. These results suggest that replacement of Trp by its analog 5-hydroxyTrp may be tolerated in anα-helix. To test this hypothesis, we have replaced Trp by 5OH-Trp in the fifth helices of two functionally active mutants of the N-terminal domain of the bacteriophage λ repressor. Computations on the packing of these helices have shown that no significant structural changes result from the replacement of Trp by 5OH-Trp. The DNA-binding activity of these mutants, as assessed indirectly through geometrical parameters, is also unaltered.     

Molecular simulation uncovers the conformational space of the λ Cro dimer in solution

The significant variation among solved structures of the λ Cro dimer suggests its flexibility. However, contacts in the crystal lattice could have stabilized a conformation which is unrepresentative of its dominant solution form. Here we report on the conformational space of the Cro dimer in solution using replica exchange molecular dynamics in explicit solvent. The simulated ensemble shows remarkable correlation with available x-ray structures. Network analysis and a free energy surface reveal the predominance of closed and semi-open dimers, with a modest barrier separating these two states. The fully open conformation lies higher in free energy, indicating that it requires stabilization by DNA or crystal contacts. Most NMR models are found to be unstable conformations in solution. Intersubunit salt bridging between Arg⁴ and Glu⁵³ during simulation stabilizes closed conformations. Because a semi-open state is among the low-energy conformations sampled in simulation, we propose that Cro-DNA binding may not entail a large conformational change relative to the dominant dimer forms in solution.     

Stationary phase-like properties of the bacteriophage λ Rex exclusion phenotype

The rex genes of bacteriophage lambda were found to protect lysogenic Escherichia coliK host cells against killing by phage T4 rII, when compared in parallel to isogenic Rex(-) lysogens and nonlysogens. This protective effect was abrogated upon mutation of the host stationary-phase sigma factor RpoS. Rex(+) lysogens infected by T4 rII contracted, formed aggregates and shed flagella, thus resembling cells entering stationary phase. These phenotypes were accentuated in nonlysogenic cells carrying multicopy plasmids expressing rexA-rexB: cells were about two-fold contracted in length, expressed membrane-bound and detached flagella, were insensitive to infection by a variety of phages and clumped extensively; in addition, cultures of these cells were odorous. Our observations support the hypothesis that the Rex system can cause a stationary-phase-like response that protects the host against infection by T4 rII.     

Mapping the interaction between the cytoplasmic domains of HIV-1 viral protein U and human CD4 with NMR spectroscopy

Viral protein?U (VpU) of HIV-1 plays an important role in downregulation of the main HIV-1 receptor CD4 from the surface of infected cells. Physical binding of VpU to newly synthesized CD4 in the endoplasmic reticulum is an early step in a pathway leading to proteasomal degradation of CD4. In this study, regions in the cytoplasmic domain of VpU involved in CD4 binding were identified by NMR spectroscopy. Amino acids in both helices found in the cytoplasmic region of VpU in membrane-mimicking detergent micelles experience chemical shift perturbations upon binding to CD4, whereas amino acids between the two helices and at the C-terminus of VpU show no or only small changes, respectively. The topology of the complex was further studied with paramagnetic relaxation enhancement. Paramagnetic spin labels were attached at three sequence positions of a CD4 peptide comprising the transmembrane and cytosolic domains of the receptor. VpU binds to a membrane-proximal region in the cytoplasmic domain of CD4. STRUCTURED DIGITAL ABSTRACT: VpU?and?CD4?bind?by?nuclear magnetic resonance?(View interaction).     

Molecular insights into the interaction of the ribosomal stalk protein with elongation factor 1α

In all organisms, the large ribosomal subunit contains multiple copies of a flexible protein, the so-called ‘stalk’. The C-terminal domain (CTD) of the stalk interacts directly with the translational GTPase factors, and this interaction is required for factor-dependent activity on the ribosome. Here we have determined the structure of a complex of the CTD of the archaeal stalk protein aP1 and the GDP-bound archaeal elongation factor aEF1α at 2.3 Å resolution. The structure showed that the CTD of aP1 formed a long extended α-helix, which bound to a cleft between domains 1 and 3 of aEF1α, and bridged these domains. This binding between the CTD of aP1 and the aEF1α•GDP complex was formed mainly by hydrophobic interactions. The docking analysis showed that the CTD of aP1 can bind to aEF1α•GDP located on the ribosome. An additional biochemical assay demonstrated that the CTD of aP1 also bound to the aEF1α•GTP•aminoacyl-tRNA complex. These results suggest that the CTD of aP1 interacts with aEF1α at various stages in translation. Furthermore, phylogenetic perspectives and functional analyses suggested that the eukaryotic stalk protein also interacts directly with domains 1 and 3 of eEF1α, in a manner similar to the interaction of archaeal aP1 with aEF1α.     

Utilization of lysine 13C-methylation NMR for protein–protein interaction studies

Chemical modification is an easy way for stable isotope labeling of non-labeled proteins. The reductive ¹³C-methylation of the amino group of the lysine side-chain by ¹³C-formaldehyde is a post-modification and is applicable to most proteins since this chemical modification specifically and quickly proceeds under mild conditions such as 4 °C, pH 6.8, overnight. ¹³C-methylation has been used for NMR to study the interactions between the methylated proteins and various molecules, such as small ligands, nucleic acids and peptides. Here we applied lysine ¹³C-methylation NMR to monitor protein–protein interactions. The affinity and the intermolecular interaction sites of methylated ubiquitin with three ubiquitin-interacting proteins were successfully determined using chemical-shift perturbation experiments via the ¹H–¹³C HSQC spectra of the ¹³C-methylated-lysine methyl groups. The lysine ¹³C-methylation NMR results also emphasized the importance of the usage of side-chain signals to monitor the intermolecular interaction sites, and was applicable to studying samples with concentrations in the low sub-micromolar range.