Structural alignment of RNA with triple helix structure

Structural alignment is useful in identifying members of ncRNAs. Existing tools are all based on the secondary structures of the molecules. There is evidence showing that tertiary interactions (the interaction between a single-stranded nucleotide and a base-pair) in triple helix structures are critical in some functions of ncRNAs. In this article, we address the problem of structural alignment of RNAs with the triple helix. We provide a formal definition to capture a simplified model of a triple helix structure, then develop an algorithm of O(mn(3)) time to align a query sequence (of length m) with known triple helix structure with a target sequence (of length n) with an unknown structure. The resulting algorithm is shown to be useful in identifying ncRNA members in a simulated genome.     

RNA helix stability in mixed Na+/Mg2+ solution

A recently developed tightly bound ion model can account for the correlation and fluctuation (i.e., different binding modes) of bound ions. However, the model cannot treat mixed ion solutions, which are physiologically relevant and biologically significant, and the model was based on B-DNA helices and thus cannot directly treat RNA helices. In the present study, we investigate the effects of ion correlation and fluctuation on the thermodynamic stability of finite length RNA helices immersed in a mixed solution of monovalent and divalent ions. Experimental comparisons demonstrate that the model gives improved predictions over the Poisson-Boltzmann theory, which has been found to underestimate the roles of multivalent ions such as Mg2+ in stabilizing DNA and RNA helices. The tightly bound ion model makes quantitative predictions on how the Na+-Mg2+ competition determines helix stability and its helix length-dependence. In addition, the model gives empirical formulas for the thermodynamic parameters as functions of Na+/Mg2+ concentrations and helix length. Such formulas can be quite useful for practical applications.     

Complex between triple helix of collagen and double helix of DNA in aqueous solution

We demonstrate in this paper that one example of a biologically important and molecular self-assembling complex system is a collagen–DNA ordered aggregate which spontaneously forms in aqueous solutions. Interaction between the collagen and the DNA leads to destruction of the hydration shell of the triple helix and stabilization of the double helix structure. From a molecular biology point of view this nano-scale self-assembling superstructure could increase the stability of DNA against the nucleases during collagen diseases and the growth of collagen fibrills in the presence of DNA.     

Model building of DNA/RNA triple helix containing L-deoxyadenosine.

A three-dimensional model of DNA/RNA triple helix that contains a poly(L-deoxyadenosine) (L-dA) chain is proposed based on computer-assisted model building and energy calculations. The model building was performed by a new method that systematically searches possible conformations of nucleotide units in the helical chains. Two possible orientations of sugar-phosphate chains, in which two homopyrimidine strands are parallel or antiparallel with each other, were considered in the systematic search. Several possible base-pairing models, in which there are one Watson-Crick base pair and one other base pair, were also considered. Many possible models selected by the systematic search were further refined through molecular mechanics calculation incorporating a helical boundary condition. The preferred model, which was selected on the basis of potential energy, was the one with Watson-Crick and Hoogsteen base pairs and with its two polypyrimidine chains in the antiparallel orientation. The model can explain the experimental observation that poly(L-dA) forms a stable triple helix with poly(uridylic acid) (U) but not with poly(deoxythymidylic acid) (dT).     

Mechanics and structural stability of the collagen triple helix

1. Download : Download high-res image (222KB)
2. Download : Download full-size image

     

Exclusion of RNA strands from a purine motif triple helix.

Research concerning oligonucleotide-directed triple helix formation has mainly focused on the binding of DNA oligonucleotides to duplex DNA. The participation of RNA strands in triple helices is also of interest. For the pyrimidine motif (pyrimidine.purine.pyrimidine triplets), systematic substitution of RNA for DNA in one, two, or all three triplex strands has previously been reported. For the purine motif (purine.purine.pyrimidine triplets), studies have shown only that RNA cannot bind to duplex DNA. To extend this result, we created a DNA triple helix in the purine motif and systematically replaced one, two, or all three strands with RNA. In dramatic contrast to the general accommodation of RNA strands in the pyrimidine triple helix motif, a stable triplex forms in the purine motif only when all three of the substituent strands are DNA. The lack of triplex formation among any of the other seven possible strand combinations involving RNA suggests that: (i) duplex structures containing RNA cannot be targeted by DNA oligonucleotides in the purine motif; (ii) RNA strands cannot be employed to recognize duplex DNA in the purine motif; and (iii) RNA tertiary structures are likely to contain only isolated base triplets in the purine motif.     

Structural constraints regulating triple helix formation by A-tracts

The study concerns the propensity of triple helix formation by different DNA oligonucleotides containing long A-tracts with and without flanking GxC base pairs in order to probe the role of length of the A-tract and the flanking sequences. From nuclear magnetic resonance (NMR) studies of imino proton spectra and circular dichroism (CD) spectroscopy of samples composed of potential triplex forming strand sequences in correct stoichiometries, we have concluded that 8-mer A-tracts flanked by GxC base pairs exert significant steric hindrance to triple helix formation. When as much as 50 mM Mg2+ was added, no triple helix formation was observed in these samples. In contrast, open-ended 8-mer A-tracts formed triplex with the corresponding two T8 strands under relatively mild ionic conditions (100 mM Na+). Moreover, the shorter the length of the A-tract, the less is the hindrance to form a triple helix.     

Effect of a 5'-phosphate on the stability of triple helix.

An effect of 5'-phosphorylation on the stability of triple helical DNA containing pyrimidine:purine:pyrimidine strands has been demonstrated by both gel electrophoresis and UV melting. A 5'-phosphate on the purine-rich middle strand of a triple helix lowers the stability of triple helix formation by approximately 1 kcal/mol at 25 degrees C. The middle strand is involved in both Watson-Crick and Hoogsteen base pairing. In contrast, a 5'-phosphate on the pyrimidine-rich strands, which are involved in either Watson-Crick or Hoogsteen base pairing, has a smaller effect on the stability of triple helix. The order of stability is: no phosphate on either strand > phosphate on both pyrimidine strands > phosphate on purine strand > phosphate on all three strands. Differential stability of triple helix species is postulated to stem from an increase in rigidity due to steric hindrance from the 5'-phosphate. This result indicates that labelling with 32P affect equilibrium in triplex formation.     

Sequence specific thermal stability of the collagen triple helix

Theoretical calculations of the thermal stability of collagen triple helices using empirical values for the contribution of individual tripeptide units are presented and compared with direct measurements of the thermal stability of various types of collagens. Relative stabilities are assigned to the positions of the tripeptide units in the amino acid sequence along the length of the collagen molecule. The sequence specific relative stabilities of type I and type XI collagens are compared. These offer insight into the reasons for the existence of unfolding intermediates in type XI collagen that are absent in type I collagen. The pattern of relative stabilities calculated for mouse type IV collagen is consistent with experimental results which indicate that the amino terminal region is very stable and that the interruptions cause increased flexibility and independently unfolding domains. Mutations in the triple helical domain of human type I procollagen occurring in brittle bone disease (osteogenesis imperfecta) show varying effects on the thermal stability of the molecule. The sequence specific thermal stability calculations shed some light on why some mutations of cysteine for glycine have greater effects on the thermal stability than others.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Structural heterogeneity of type I collagen triple helix and its role in osteogenesis imperfecta

We investigated regions of different helical stability within human type I collagen and discussed their role in intermolecular interactions and osteogenesis imperfecta (OI). By differential scanning calorimetry and circular dichroism, we measured and mapped changes in the collagen melting temperature (DeltaTm) for 41 different Gly substitutions from 47 OI patients. In contrast to peptides, we found no correlations of DeltaTm with the identity of the substituting residue. Instead, we observed regular variations in DeltaTm with the substitution location in different triple helix regions. To relate the DeltaTm map to peptide-based stability predictions, we extracted the activation energy of local helix unfolding (DeltaG) from the reported peptide data. We constructed the DeltaG map and tested it by measuring the H-D exchange rate for glycine NH residues involved in interchain hydrogen bonds. Based on the DeltaTm and DeltaG maps, we delineated regional variations in the collagen triple helix stability. Two large, flexible regions deduced from the DeltaTm map aligned with the regions important for collagen fibril assembly and ligand binding. One of these regions also aligned with a lethal region for Gly substitutions in the alpha1(I) chain.     

Contribution of dipole-dipole interactions to the stability of the collagen triple helix

Unveiling sequence-stability and structure-stability relationships is a major goal of protein chemistry and structural biology. Despite the enormous efforts devoted, answers to these issues remain elusive. In principle, collagen represents an ideal system for such investigations due to its simplified sequence and regular structure. However, the definition of the molecular basis of collagen triple helix stability has hitherto proved to be a difficult task. Particularly puzzling is the decoding of the mechanism of triple helix stabilization/destabilization induced by imino acids. Although the propensity-based model, which correlates the propensities of the individual imino acids with the structural requirements of the triple helix, is able to explicate most of the experimental data, it is unable to predict the rather high stability of peptides embedding Gly-Hyp-Hyp triplets. Starting from the available X-ray structures of this polypeptide, we carried out an extensive quantum chemistry analysis of the mutual interactions established by hydroxyproline residues located at the X and Y positions of the Gly-X-Y motif. Our data clearly indicate that the opposing rings of these residues establish significant van der Waals and dipole-dipole interactions that play an important role in triple helix stabilization. These findings suggest that triple helix stabilization can be achieved by distinct structural mechanisms. The interplay of these subtle but recurrent effects dictates the overall stability of this widespread structural motif.     

Structure, stability, and thermodynamics of a short intermolecular purine-purine-pyrimidine triple helix

We have investigated the structure and physical chemistry of the d(C3T4C3).2[d(G3A4G3)] triple helix by polyacrylamide gel electrophoresis (PAGE), 1H NMR, and ultraviolet (UV) absorption spectroscopy. The triplex was stabilized with MgCl2 at neutral pH. PAGE studies verify the stoichiometry of the strands comprising the triplex and indicate that the orientation of the third strand in purine-purine-pyrimidine (pur-pur-pyr) triplexes is antiparallel with respect to the purine strand of the underlying duplex. Imino proton NMR spectra provide evidence for the existence of new purine-purine (pur.pur) hydrogen bonds, in addition to those of the Watson-Crick (W-C) base pairs, in the triplex structure. These new hydrogen bonds are likely to correspond to the interaction between third-strand guanine NH1 imino protons and the N7 atoms of guanine residues on the purine strand of the underlying duplex. Thermal denaturation of the triplex proceeds to single strands in one step, under the conditions used in this study. Binding of the third strand appears to enhance the thermal stability of the duplex by 1-3 degrees C, depending on the DNA concentration. The free energy of triplex formation (-26.0 +/- 0.5 kcal/mol) is approximately twice that of duplex formation (-12.6 +/- 0.7 kcal/mol), suggesting that the overall stability of the pur.pur base pairs is similar to that of the W-C base pairs.(ABSTRACT TRUNCATED AT 250 WORDS)     

The chain register in heterotrimeric collagen peptides affects triple helix stability and folding kinetics

Collagen type IV is a highly specialized form of collagen found only in basement membranes, where it provides mechanical stability and structural integrity to tissues and organs, and binding sites for cell adhesion. In its ubiquitous form, collagen type IV consists of two alpha1 chains and one alpha2 chain, whose internal alignment within the triple helix seems to exert a strong influence on the binding affinity to alpha1beta1 integrin receptor. This has been assessed recently using two synthetic collagen peptides that contain the cell adhesion epitope of collagen type IV and are assembled into the most plausible alpha1alpha2alpha1' and alpha2alpha1alpha1' registers. In the present study, the effects of the chain register on the stability of the triple helix and the folding kinetics of these collagen peptides were investigated by CD spectroscopy and microcalorimetry. The results revealed a multi-domain structural organization for both trimers, with an unexpected strong effect of the chain alignment on the conformational stability. Molecular dynamics simulations served to rationalize more properly the experimental results.     

High salt solution structure of a left-handed RNA double helix

Right-handed RNA duplexes of (CG)_n sequence undergo salt-induced helicity reversal, forming left-handed RNA double helices (Z-RNA). In contrast to the thoroughly studied Z-DNA, no Z-RNA structure of natural origin is known. Here we report the NMR structure of a half-turn, left-handed RNA helix (CGCGCG)₂ determined in 6 M NaClO₄. This is the first nucleic acid motif determined at such high salt. Sequential assignments of non-exchangeable proton resonances of the Z-form were based on the hitherto unreported NOE connectivity path [H6_(n)-H5′/H5″_(n)-H8_(n+1)-H1′_(n+1)-H6_(n+2)] found for left-handed helices. Z-RNA structure shows several conformational features significantly different from Z-DNA. Intra-strand but no inter-strand base stacking was observed for both CpG and GpC steps. Helical twist angles for CpG steps have small positive values (4–7°), whereas GpC steps have large negative values (−61°). In the full-turn model of Z-RNA (12.4 bp per turn), base pairs are much closer to the helix axis than in Z-DNA, thus both the very deep, narrow minor groove with buried cytidine 2′-OH groups, and the major groove are well defined. The 2′-OH group of cytidines plays a crucial role in the Z-RNA structure and its formation; 2′-O-methylation of cytidine, but not of guanosine residues prohibits A to Z helicity reversal.     

Alpha-oligonucleotides with anionic phosphodiester and cationic phosphoramidate linkages enhanced stability of DNA triple helix

Synthesis of several alpha-oligonucleotides containing both anionic phosphodiester and cationic N-(dimethylaminopropyl)phosphoramidate internucleosidic linkages is described. Their ability to form triple helix with dsDNA was evaluated at various pH by UV melting experiments.     

Human therapeutics based on triple helix technology.

The application of triple helix technology to rational drug discovery is rapidly leading to the development of a new class of drugs, initially applicable for the effective and specific treatment of viral infections and, eventually, perhaps, cancer and immunological disorders. Issues such as stability, delivery, specificity, in vitro efficacy and acute toxicity, and the cost of synthesis are already being addressed: preliminary studies are yielding promising results. Further chemical modification of the oligonucleotides will probably be necessary to enhance affinity and efficacy, and comprehensive studies on the pharmacokinetics, toxicity, mutagenicity and in vivo efficacy of these compounds are still required. These, as well as scale-up synthesis and pharmaceutical formulation issues, are the focus of the R&D programs of a number of pharmaceutical laboratories.     

Polyamine-linked oligonucleotides for DNA triple helix formation.

The concept of antigene therapy of disease is based on the ability of an oligonucleotide (the therapeutic agent) to bind to double-stranded genomic DNA (the target associated with the disease). Examples are herein given of the linkage of a series of polyamines to a 21-mer homopyrimidine oligonucleotide. These conjugated 21-mers can each form a triple helix with an appropriate double-stranded homopurine-homopyrimidine DNA according to Hoogsteen base-pairing rules. No triple helix was found when unmodified third strand was used at 10 mM sodium phosphate, pH 6.5, 100 mM sodium chloride solution. In contrast, the spermine-conjugated oligonucleotide had a melting temperature of 42 degrees C. According to the melting profile, the appended spermine moiety was found to affect the Tm only of the triple helix, but not of the subsequent melting of the underlying double helix. The Tm enhancing ability of the spermine-conjugate was found to be better than that of other polyamine-conjugates.     

Coevolution of RNA helix stability and Shine-Dalgarno complementarity in a translational start region

The initiation legion of the coat-protein gene of RNA bacteriophage MS2 adopts a well-defined hairpin structure with the start codon occupying the loop position, while the Shine-Dalgarno (SD) sequence is part of the stem. In a previous study, we introduced mutations in this hairpin that changed its thermo dynamic stability. The resulting phages evolved to regain the wild-type stability by second-site compensatory substitutions. Neither the original nor the suppressor mutations were in the SD region. In the present analysis, we have made changes in the SD region that shorten or extend its complementarity to the 3 end of 16S rRNA and monitored their evolution to a stable pseudorevertant species. Phages in which the SD complementarity was decreased evolved an initiator hairpin of lower stability than wild type while those in which the complementarity was extended evolved a hairpin with an increased stability. We conclude that weaker SD sequences still allow maximal translation if the secondary structure of the ribosome-landing site is destabilized accordingly. Alternatively, translation-initiation regions with a stronger secondary structure still allow maximal expression, if the SD complementarity is extended. These findings support a previously published model in which the SD Interaction helps the ribosome to melt the structure in a translation-initiation region.