Hybridization analysis of D4Z4 repeat arrays linked to FSHD

Facioscapulohumeral muscular dystrophy (FSHD) is an autosomal dominant disease involving shortening of D4Z4, an array of tandem 3.3-kb repeat units on chromosome 4. These arrays are in subtelomeric regions of 4q and 10q and have 1–100 units. FSHD is associated with an array of 1–10 units at 4q35. Unambiguous clinical diagnosis of FSHD depends on determining the array length at 4q35, usually with the array-adjacent p13E-11 probe after pulsed-field or linear gel electrophoresis. Complicating factors for molecular diagnosis of FSHD are the phenotypically neutral 10q D4Z4 arrays, cross-hybridizing sequences elsewhere in the genome, deletions including the genomic p13E-11 sequence and part of D4Z4, translocations between 4q and 10q D4Z4 arrays, and the extremely high G + C content of D4Z4 arrays (73%). In this study, we optimized conditions for molecular diagnosis of FSHD with a 1-kb D4Z4 subfragment probe after hybridization with p13E-11. We demonstrate that these hybridization conditions allow the identification of FSHD alleles with deletions of the genomic p13E-11 sequence and aid in determination of the nonpathogenic D4Z4 arrays at 10q. Furthermore, we show that the D4Z4-like sequences present elsewhere in the genome are not tandemly arranged, like those at 4q35 and 10q26.     

Genomic analysis of human chromosome 10q and 4q telomeres suggests a common origin

The subtelomeric region of human chromosome 4q contains the locus for facioscapulohumeral muscular dystrophy (FSHD). The FSHD mutation is a deletion within an array of 3.3-kb tandem repeats (D4Z4). The disease mechanism is unknown but is postulated to involve position effect. A closely related 3.3-kb array on chromosome 10qter, in contrast, is not associated with a disease phenotype. We show here that the 4q homology on chromosome 10 is not confined to the 3.3-kb repeats but extends both proximally (42 kb) and distally to include the telomere. We have also identified the most distal expressed gene on 10q known so far, mapping only 96 kb from the 3.3-kb repeat array. A 4q variant has also been identified; there is 92%nucleotide identity between the two 4q forms, 4qA and 4qB. The 4qter and 10qter forms show homology to other chromosome ends, including 4p, 21q, and 22q, and these regions may represent a relatively common subtelomeric domain.     

Improved characterization of FSHD mutations

Facioscapulohumeral muscular dystrophy (FSHD) is caused by the shortest alleles of the 3.3kb-tandem repeat array D4Z4 at 4q35. Molecular diagnosis of FSHD depends upon the separation of unusually large alleles by pulse-field electrophoresis after EcoRI and EcoRI/BlnI digestion. The exact number of alleles could not however be directly inferred from the size of DNA fragments owing to polymorphisms in the telomeric region of the locus. Knowing the exact repeat number of disease causing alleles may benefit genetic counselling, help to understand the mechanism of this singular disease and the population dynamics of subtelomeric sequences variations. We present here a partial digestion mapping method giving the exact number of repeats for disease causing alleles, and we suggest that most inaccuracies induced by common polymorphisms could be reduced by using EcoRV in place of EcoRI. After studying more than 300 DNA samples with both the standard method and this new method, we show that alleles size can be evaluated with a precision of less than one half repeat, and that the variations in length of the truncated repeat in the telomeric region of the D4Z4 locus can be evaluated. The results suggest that at least one intact chromosome 4 type repeat at 4q35 is needed to cause FSHD.     

A dysmorphic newborn with 45,X,der(1)inv(1)(p13;qter)t(Y;1)(pter-->q11;p13),-Y de novo karyotype

A dysmorphic newborn with 45,x,der(1)inv(1)(p13;qter)t(y;1)(pter-->q11;p13),-Y de novo karyotype: Y/autosome translocations are very rare chromosomal rearrangements. In most cases, the long arm of the Y chromosome is translocated onto an autosome and most patients are referred because of male infertility. Y/1 translocations are very rare, and have been reported in seven patients so far. Pericentric inversions may be seen in all chromosomes and are not associated with phenotypic abnormalities. Here we report a 6-day old male baby with prenatal growth retardation, frontal bossing, hypertelorism, micrognathia, cleft soft palate, absent uvula, hypospadias, simian line in both hands and hammer toes. Cytogenetic analysis was performed with GTG-banding, C-banding and FISH analysis containing X centromeric probe, Yq12-qter locus specific probe and whole chromosome Y probe. An unbalanced Y/1 translocation was diagnosed: 45,X,der(1)inv(1)(p13;qter)t(Y;1)(pter-->q11;p13),-Y.     

Masked complex chromosome rearrangement in a child thought to have del(8qter) as the sole cytogenetic abnormality

Cytogenetic analyses of constitutional diseases have disclosed several chromosomal rearrangements. At the molecular level, these rearrangements often result in the breakage of genes or alteration of genome architecture. Fluorescence in situ hybridization (FISH) and molecular investigations of a patient showing hypotonia and dysmorphic traits revealed a masked complex chromosome abnormality previously detected by G-banding as a simple 8qter deletion. To characterize the genetic rearrangements panels of bacterial artificial chromosomes (BACs) covering 8q24.22-->qter were constructed, and short tandem repeats (STRs) were used to refine the localization of the breakpoints and to assess the parental origin of the defect. Chromosome 8 displayed the breakpoint at 8q24.22 and an unexpected distal breakpoint at 8q24.23 resulting in unbalanced translocation of a small 8q genomic region on the chromosome 16qter. The study of the 16qter region revealed that the 16q subtelomere was retained and the translocated material of distal 8q was juxtaposed. Moreover, molecular analyses showed that part of the translocated 8qter segment on der(16) was partially duplicated, inverted and that the rearrangement arose in the paternal meiosis. These findings emphasize the complexity of some only apparently simple chromosomal rearrangements and suggest a subtelomeric FISH approach to enhance diagnostic care when a cytogenetic terminal deletion is found.     

The donor chromosome breakpoint for a jumping translocation is associated with large low-copy repeats in 21q21.3

Jumping translocations (JTs) are very rare chromosome aberrations, usually identified in tumors. We report a constitutional JT between donor chromosome 21q21.3-->qter and recipients 13qter and 18qter, resulting in an approximately 15.5-Mb proximal deletion 21q in a girl with mild developmental delay and minor dysmorphic features. Using fluorescence in situ hybridization (FISH) studies, we identified an approximately 550-kb complex inter- and intra-chromosomal low-copy repeat (LCR) adjacent to the 21q21.3 translocation breakpoint. On the recipient chromosomes 13qter and 18qter, the telomeric sequences TTAGGG were retained. Genotyping revealed that the deletion was of maternal origin. We propose that genome architecture involving LCRs may be a major mechanism responsible for the origin of jumping translocations.     

Two sibs with duplication of 4q31-->qter due to 3:1 meiotic disjunction and mild phenotype

Two sibs with duplication of 4q31-->qter due to 3:1 meiotic disjunction and mild phenotype: Clinical and cytogenetic findings in two sibs with partial duplication of 4q31.3-->qter and 21q11.2-->pter are reported. These patients are rare cases of reoccurrence of those partial trisomies due to 3:1 segregation of a maternal balanced translocation. A review of the literature reporting cases of trisomy of the 4q31-->qter segment is also made; previously reported cases mostly in addition have deletions of other chromosomes resulting from adjacent segregation of balanced translocation. The findings of our study confirm the high risk for offspring with unbalanced rearrangements in women with reciprocal translocation involving acrocentric and short chromosome segments. The study also points out that duplication of 4q31-->qter may go along with only mild phenotypic findings if there is no significant additional aneuploidy of the other chromosome involved in the rearrangement.     

Chromosomal localization of human endogenous retroviral element ERV1 to 18q22----q23 by in situ hybridization

From a clone containing the entire locus of human endogenous retroviral element ERV1, we have obtained a DNA probe that is specific for the 3' long terminal repeat (LTR) sequence. This probe was used to map the LTR of ERV1 by in situ hybridization to chromosomes from normal human blood lymphocytes. The LTR was found to be localized to the distal portion of the long arm of human chromosome 18, within bands q22----q23. This chromosome locus is near the constitutive fragile site at band q21.3 on chromosome 18 associated with the 14;18 translocations seen in follicular lymphomas.     

Monosomy 10 qter

Summary An 11-year-old girl with 10q26qter deletion is described and compared with another patient reported in the literature. The most characteristic features of monosomy 10qter seem to be: severe mental retardation; growth retardation; microcephaly; and facial dysmorphism with a long and triangular facies, a broad and prominent nasal bridge, a poorly developed tip of the nose, a short philtrum, and flattened angles of the mandible. Several of these features are opposed in type and countertype to features of trisomy 10qter.Chargé de Recherche C.N.R.S.     

Distal trisomy of 10q. Report of a new case of duplication 10q25.2-25.3-->qter defined by FISH

In the present work, we report on a 2.5-year-old male patient with typical clinical features of partial trisomy of the distal third of chromosome 10 long arm. The karyotype was: 46,XY, dir dup(10)(q25.2-25.3-->qter). The identification of the duplicated segment was carried out by the fluorescence in situ hybridization technique using region-specific probes. The proband's phenotype is compared with previously reported cases.     

de novo inversion-duplication of 2q35-2qter without growth retardation.

A 7-year-old mentally retarded child was found to be the carrier of a de novo inversion-duplication of 2q35-2qter. His phenotype corresponded to that which is classically described in cases of partial trisomy of the long arm of chromosome 2; however, he did not show the growth retardation which usually characterizes this and other aneuploidy syndromes.     

Assignment of the structural gene encoding human aspartylglucosaminidase to the long arm of chromosome 4 (4q21----4qter)

The structural gene for the human lysosomal enzyme aspartylglucosaminidase (AGA) has been assigned to chromosome 4 using somatic cell hybridization techniques. The human monomeric enzyme was detected in Chinese hamster-human cell hybrids by a thermal denaturation assay that selectively inactivated the Chinese hamster isozyme, while the thermostable human enzyme retained activity. Twenty informative hybrid clones, derived from seven independent fusions, were analyzed for the presence of human AGA activity and their human chromosomal constitutions. Without exception, the presence of human AGA in these hybrids was correlated with the presence of human chromosome 4. All other human chromosomes were excluded by discordant segregation of the human enzyme and other chromosomes. Two hybrid clones, with interspecific Chinese hamster-human chromosome translocations involving the long arm of human chromosome 4, permitted the assignment of human AGA to the region 4q21----4qter.     

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.     

Genetic organization of the KpnI restriction--modification system.

The KpnI restriction-modification (KpnI RM) system was previously cloned and expressed in E. coli. The nucleotide sequences of the KpnI endonuclease (R.KpnI) and methylase (M. KpnI) genes have now been determined. The sequence of the amino acid residues predicted from the endonuclease gene DNA sequence and the sequence of the first 12 NH2-terminal amino acids determined from the purified endonuclease protein were identical. The kpnIR gene specifies a protein of 218 amino acids (MW: 25,115), while the kpnIM gene codes for a protein of 417 amino acids (MW: 47,582). The two genes transcribe divergently with a intergeneic region of 167 nucleotides containing the putative promoter regions for both genes. No protein sequence similarity was detected between R.KpnI and M.KpnI. Comparison of the amino acid sequence of M.KpnI with sequences of various methylases revealed a significant homology to N6-adenine methylases, a partial homology to N4-cytosine methylases, and no homology to C5-methylases.     

Trisomy 4q26--4qter by t(4;18)(q26;q23)mat translocation]

Partial trisomy 4q and perhaps monosomy 8qter was observed in a malformed girl, due to malsegregation of a t(4;18)(q26;q23)mat. Her phenotype was in agreement with the partial trisomy 4q syndrome, and she died 5 months after birth.     

Prenatal diagnosis of partial trisomy 3q (3q27.3→qter) and partial monosomy 14q (14q31.3→qter) of paternal origin associated with fetal hypotonia,arthrogryposis, scoliosis and hyperextensible joints

We present rapid aneuploidy diagnosis of partial trisomy 3q (3q27.3→qter) and partial monosomy 14q (14q31.3→qter) of paternal origin by aCGH using uncultured amniocytes in a fetus with hypotonia, scoliosis, arthrogryposis, hyperextensible joints, facial dysmorphism, ventricular septal defect, pulmonary stenosis, clenched hands, clubfoot, scalp edema and right hydronephrosis. We discuss the genotype–phenotype correlation of 3q duplication syndrome and terminal 14q deletion syndrome. We demonstrate that fetuses with a paternal-origin deletion of 14q involving the 14q32.2 imprinted region may prenatally present the upd(14)mat-like phenotype such as hypotonia, scoliosis, arthrogryposis and hyperextensible joints.     

In situ hybridization and translocation breakpoint mapping. II. Two unusual t(21;22) translocations

Using a combination of banding techniques, we examined two atypical 21;22 translocations, 46,XX or XY,t(21;22)(p11;q11). In situ chromosomal hybridization of a probe for the constant region of the lambda light chain locus demonstrated that the 22q11 breakpoints of both rearrangements were proximal to the C lambda gene cluster. These studies permitted us to distinguish the 22q11 breakpoints of these translocations from the breakpoint of the 22q--chromosome of chronic myelogenous leukemia.     

Strand-specific fluorescence in situ hybridization: the CO-FISH family

The ability to prepare single-stranded chromosomal target DNA allows innovative uses of FISH technology for studies of chromosome organization. Standard FISH methodologies require functionally single-stranded DNAs in order to facilitate hybridization between the probe and the complementary chromosomal target sequence. This usually involves denaturation of double-stranded probes to induce temporary separation of the DNA strands. Strand-specific FISH (CO-FISH; Chromosome Orientation-FISH) involves selective removal of newly replicated strands from DNA of metaphase chromosomes which results in single-stranded target DNA. When single-stranded probes are then hybridized to such targets, the resulting strand-specific hybridization is capable of revealing a level of information previously unattainable at the cytogenetic level. Mammalian telomeric DNA consists of tandem repeats of the (TTAGGG) sequence, oriented 5'-->3' towards the termini of all vertebrate chromosomes. Based on this conserved structural organization, CO-FISH with a telomere probe reveals the absolute 5'-->3' orientation of DNA sequences with respect to the pter-->qter direction of chromosomes. Development and various applications of CO-FISH will be discussed: detection of cryptic inversions, discrimination between telomeres produced by leading- versus lagging-strand synthesis, and replication timing of mammalian telomeres.