Lipid peroxidation contributes to age-related membrane rigidity

The aim of this work was to assess the relative contributions of lipid peroxidation and cholesterol content to the increase in membrane rigidity observed during senescence. Membrane fluidity was manipulated through exposure to peroxidized or cholesterol-loaded liposomes. Small unilamella liposomes were prepared and either peroxidized by Fe⁺⁺-ADP-ascorbic acid or loaded with cholesterol. After incorporation of the liposomes into rat liver microsomal membranes, membrane fluidity was quantitated by measuring changes in polarization. Membranes exhibited a greater sensitivity to peroxidation than cholesterol in that incorporation of peroxidized liposomes induced microsomal membrane rigidity substantially more than did cholesterol-loaded liposomes. Thus it is proposed, based on data from the present and earlier studies, that membrane fluidity can be modulated readily by lipid peroxidation of membrane phospholipids, irrespective of the influences of cholesterol. These results support the proposal that alterations of lipid structure are more potent and effective than compositional changes in cholesterol in inducing age-related increases in membrane rigidity.     

Kinetic evaluation of lipophilic inhibitors of lipid peroxidation in DLPC liposomes

The authors have developed a kinetic method that allows one to obtain relative reactivity constants for lipophilic antioxidants in free radical systems. Two experimental model systems were developed: (a) a methanolic solution using AMVN as the free radical initiator and linoleic acid as the substrate, and (b) a multilamellar vesicle system composed of dilinoleoylphosphatidylcholine and AAPH as the substrate and the initiator, respectively. The use of these two systems allows researchers not only to determine the intrinsic reactivity of a potential antioxidant, but also to evaluate its potency in a membranous system where the contribution of the physical properties of the antioxidant to the inhibition of lipid peroxidation is important. These results show that all antioxidants tested acted in these systems as free radical scavengers, and they validate the synergism between intrinsic scavenging ability and membrane affinity and/or membrane-modifying physical properties in the inhibition of lipid peroxidation.     

Lipid peroxidation products in human subretinal fluid

The concentrations of thiobarbituric acid reacting substances (TBARS) and proteins in the subretinal fluid (SF) of patients undergoing retinal detachment surgery have been determined. We have tried to establish the correlations between these biochemical and other clinical features of these patients: evolution time of the retinal detachment, age, degree of myopia, and macular affection. Caucasian patients, 19 men and 19 women (57.42 ±12.85 average age, interval 20–80) were randomly selected for this study. SF samples were obtained by puncture after scleral indentation. TBARS and protein concentrations were determined by the corresponding colorimetric assays. A linear correlation exists between TBARS and protein contents in these samples. No correlation could be established between evolution time of the retinal detachment and TBARS content in SF. TBARS in SF increases with increasing age in nonmyopic patients. In the samples of myopic patients the correlation was established between TBARS content and degree of myopia. The group of patients with more than 10 dioptres show a significant higher TBARS concentration in SF than any of the other groups studied. It can be concluded that lipid peroxidation products in SF originate, at least partially, from rod outer segments, and that lipid peroxidation is a process that might play a role in the pathogenesis of retinal detachment, specially in myopic patients.     

Involvement of lipid peroxidation and organic peroxides in UVA-induced matrix metalloproteinase-1 expression

Ultraviolet A (UVA) irradiation causes human skin aging and skin cancer at least partially through the activation of matrix metalloproteinases (MMPs). MMP-1, the interstitial collagenase, is responsible for the degradation of collagen and is involved in tumor progression in human skin. The present study uses human skin fibroblast cells (FEK4) to investigate the involvement of lipid peroxidation and the role of peroxides as possible mediators in MMP-1 activation by UVA. Preincubation with the antioxidants butylated hydroxytoluene and Trolox reduced UVA-dependent MMP-1 upregulation, suggesting that peroxidation of membrane lipids is involved. Blocking the iron-driven generation of lipid peroxides and hydroxyl radicals by different iron chelators led to a decrease in UVA-induced MMP-1 mRNA accumulation. Moreover, modulation of glutathione peroxidase activity by use of the specific inhibitor mercaptosuccinate (MS) or by the depletion of glutathione (using buthionine-S, R-sulfoximine, BSO), enhanced the UVA-dependent MMP-1 response. Finally, UVA irradiation generated a significant increase in intracellular peroxide levels which is augmented by pretreatment of the cells with BSO or MS. Our results demonstrate that lipid peroxidation and the production of peroxides are important events in the signalling pathway of MMP-1 activation by UVA.     

Endogenous ubiquinol prevents protein modification accompanying lipid peroxidation in beef heart submitochondrial particles

This article is a study of the relationship between lipid peroxidation and protein modification in beef heart submitochondrial particles, and the protective effect of endogenous ubiquinol (reduced coenzyme Q) against these effects. ADP-Fe^3· and ascorbate were used to initiate lipid peroxidation and protein modification, which were monitored by measuring TBARS and protein carbonylation, respectively. Endogenous ubiquinone was reduced by the addition of succinate and antimycin. The parameters investigated included extraction and reincorporation of ubiquinone, and comparison of the effect of ubiquinol with those of various antioxidant compounds and enzymes, as well as the iron chelator EDTA. Under all conditions employed there was a close correlation between lipid peroxidation and protein carbonylation, and the inhibition of these effects by endogenous ubiquinol. SDS-PAGE analysis revealed a differential effect on individual protein components and its prevention by ubiquinol. Conceivable mechanisms behind the observed oxidative modifications of membrane phospholipids and proteins and of the role of ubiquinol in preventing these effects are considered.     

Plasma copper and lipid peroxidation in cigarette smokers

Plasma levels of copper and lipid peroxidation were evaluated in 14 smokers as compared to 14 nonsmokers. Plasma copper concentrations were higher in smokers than in nonsmokers (122.5 ± 19.15 vs. 101.5 ± 16.2 μg/dl, P < .01). Plasma lipoperoxidation, evaluated as fluorescent damage products of lipid peroxidation (FDPL), also was higher in smokers than in nonsmokers (20.35 ± 2.6 vs. 17.1 ± 2.95 units of relative fluorescence/ml, P < .01). A significant and positive correlation between the number of cigarettes smoked, expressed as pack years, and the levels of either FDPL (r = .61, P < .025) or copper (r = .55, P < .05) was found. Moreover, a significant and positive relationship between copper and FDPL values was observed in smokers (r = .64; P < .025), but not in nonsmokers. These data indicate that cigarette smoke-related plasma oxidant load may be partly due to enhanced levels of the prooxidant metal copper, potentially suggesting the supplementation of specific antioxidants (e.g., zinc) to counteract cigarette smoke-induced oxidative stress in smokers.     

Lipid peroxidation: mechanisms, inhibition, and biological effects

In the last 50 years, lipid peroxidation has been the subject of extensive studies from the viewpoints of mechanisms, dynamics, product analysis, involvement in diseases, inhibition, and biological signaling. Lipids are oxidized by three distinct mechanisms; enzymatic oxidation, non-enzymatic, free radical-mediated oxidation, and non-enzymatic, non-radical oxidation. Each oxidation mechanism yields specific products. The oxidation of linoleates and cholesterol is discussed in some detail. The relative susceptibilities of lipids to oxidation depend on the reaction milieu as well as their inherent structure. Lipid hydroperoxides are formed as the major primary products, however they are substrates for various enzymes and they also undergo various secondary reactions. Phospholipid hydroperoxides, for example, are reduced to the corresponding hydroxides by selenoproteins in vivo. Various kinds of antioxidants with different functions inhibit lipid peroxidation and the deleterious effects caused by the lipid peroxidation products. Furthermore, the biological role of lipid peroxidation products has recently received a great deal of attention, but its physiological significance must be demonstrated in future studies.     

Melatonin reduces both basal and bacterial lipopolysaccharide-induced lipid peroxidation in vitro

The protective effect of melatonin against lipopolysaccharide (LPS)-induced oxidative damage was examined in vitro. Lung, liver, and brain malonaldehyde (MDA) plus 4-hydroxyalkenals (4-HDA) concentrations were measured as indices of induced membrane peroxidative damage. Homogenates of brain, lung, and liver were incubated with LPS at concentrations of either 1, 10, 50, 200, or 400μg/ml for 1 h and, in another study, LPS at a concentration of 400 μg/ml for either 0, 15, 30, or 60 min. Melatonin at increasing concentrations from 0.01–3 mM either alone or together with LPS (400μg/ml) was used. Liver, brain, and lung MDA + 4-HDA levels increased after LPS at concentrations of 10, 50, 200 or 400 μg/ml; this effect was concentration-dependent. The highest levels of lipid peroxidation products were observed after tissues were incubated with an LPS concentration of 400 μg/ml for 60 min; in liver and lung this effect was totally suppressed by melatonin and partially suppressed in brain in a concentration-dependent manner. In addition, melatonin alone was effective in brain at concentrations of 0.1 to 3 mM, in lung at 2 to 3 mM, and in liver at 0.1 to 3 mM; in all cases, the inhibitory effects of melatonin on lipid peroxidation were always directly correlated with the concentration of melatonin in the medium. The results show that the direct effect of LPS on the lipid peroxidation following endotoxin exposure is markedly reduced by melatonin.     

Role of vitamin E as a lipid-soluble peroxyl radical scavenger: in vitro and in vivo evidence

Multiple reactive oxygen/nitrogen species induce oxidative stress. Mammals have evolved with an elaborate defense network against oxidative stress, in which multiple antioxidant compounds and enzymes with different functions exert their respective roles. Radical scavenging is one of the essential roles of antioxidants and vitamin E is the most abundant and important lipophilic radical-scavenging antioxidant in vivo. The kinetic data and physiological molar ratio of vitamin E to substrates show that the peroxyl radicals are the only radicals that vitamin E can scavenge to break chain propagation efficiently and that vitamin E is unable to act as a potent scavenger of hydroxyl, alkoxyl, nitrogen dioxide, and thiyl radicals in vivo. The preventive effect of vitamin E against the oxidation mediated by nonradical oxidants such as hypochlorite, singlet oxygen, ozone, and enzymes may be limited in vivo. The synergistic interaction of vitamin E and vitamin C is effective for enhancing the antioxidant capacity of vitamin E. The in vitro and in vivo evidence of the function of vitamin E as a peroxyl radical-scavenging antioxidant and inhibitor of lipid peroxidation is presented.     

Antioxidant effect of caeruloplasmin on microsomal lipid peroxidation

Microsomal NADPH-dependent lipid peroxidation catalyzed by ADP-Fe³⁺ was inhibited by the addition of caeruloplasmin. The antioxidant effect of caeruloplasmin was independent of the superoxide anion (O^?₂ scavenging activity. Since caeruloplasmin enhanced the function of ADP-Fe³⁺ acting as electron acceptor for microsomal electron transport system, the antioxidant effect of caeruloplasmin is considered to depend on the ferroxidase activity.     

Markers for oxidative stress associated with soft rots in French beans (Phaseolus vulgaris) infected by Botrytis cinerea

The role of active oxygen species has been studied in spreading soft-rot lesions caused by the necrotrophic fungal pathogen Botrytis cinerea Pers.:Fr. in leaves of four genotypes of French bean (Phaseolus vulgaris L.). Large increases were observed for the aldehydic end-products of oxidative damage, malondialdehyde and 4-hydroxy-2-nonenal, as a result of infection in each of the genotypes studied. Similar increases were found in a stable free radical and g=4.27 Fe(III) signals, but not Mn(II) signals, in electron paramagnetic resonance spectra. These changes were accompanied by large decreases in ascorbic acid levels, with changes in the antioxidant glutathione being genotype dependent. Received: 3 May 2000 / Accepted: 13 July 2000     

Trolox C, a lipid-soluble membrane protective agent, attenuates myocardial injury from ischemia and reperfusion

The lipophilic antioxidant Trolox C, a vitamin E analog, was administered to isolated, buffer-perfused rabbit hearts subjected to 25 min of global stop-flow ischemia and 30 min of reperfusion. In six hearts, Trolox C (200 microM) was infused for 15 min immediately prior to ischemia and for the first 15 min of reperfusion. Six control hearts received only vehicle. Gas chromatography analysis confirmed that effective myocardial levels of Trolox were attained. At 30 min reperfusion, the recovery of left ventricular developed pressure was 56 +/- 3% of baseline in control hearts versus 70 +/- 4% in Trolox-treated hearts (p < .01). There was also significant improvement in recovery of Trolox-treated hearts in diastolic pressure and both maximum and minimum values of the first derivative of left ventricular pressure (dP/dt). Creatine phosphokinase release into the coronary effluent at 30 min of reperfusion was 16.5 +/- 8.4 IU/min in untreated and 6.3 +/- 1.0 IU/min (p < .05) in Trolox-treated hearts. Thus Trolox C, a lipophilic antioxidant, attenuated myocardial injury during stop-flow ischemia and reperfusion.     

Inhibition of copper-induced lipid peroxidation by sinapic acid and its derivatives in correlation to their effect on the membrane structural properties

The efficiencies of sinapic acid and its derivatives syringic acid, syringaldehyde, three sinapoyl esters (ethyl, propyl, butyl sinapates), 4-vinylsyringol and sinapine were investigated for prevention of lipid peroxidation in correlation with their interactions with model lipid membrane systems. Significant antioxidant activities of propyl and butyl sinapates were seen by fluorimetric assay in phosphatidylcholine liposomes as model membrane using C11-BODIPY^581/591 lipophilic fluorescent probe. The sinapic acid esters also had the highest impact on membrane structural properties, as observed by differential scanning calorimetry and fluorescence polarisation measurements. The greatest protection of phospholipids from peroxidation by these esters correlated well with their polarity and insertion into the lipid bilayer.     

Antioxidant properties of resveratrol and piceid on lipid peroxidation in micelles and monolamellar liposomes

The antioxidant activities of trans-resveratrol (trans-3,5,4′-trihydroxystilbene) and trans-piceid (trans-5,4′-dihydroxystilbene-3-O-β-d-glucopyranoside), its more widespread glycosilate derivative, have been compared measuring their inhibitory action on peroxidation of linoleic acid (LA) and the radical scavenging ability towards different free radicals (such as DPPH) and radical initiators. It has been found that the two stilbenes have similar antioxidant capacity, while the comparison with BHT (2,6-di-tert-butyl-4-methylphenol) and -tocopherol (vitamin E, vit. E), taken as reference, points out a slower but prolonged protective action against lipid peroxidation. Furthermore, piceid appears more efficacious than resveratrol as a consequence of the reaction of the latter with its radical form.

The DSC profiles of phosphatidylcholine liposomes of various chain lengths, and EPR measurements of spin labelled liposomes demonstrated that the susceptible hydroxyl group of these compounds are located in the lipid region of the bilayer close to the double bonds of polyunsatured fatty acids, making these stilbenes particularly suitable for the prevention and control of the lipid peroxidation of the membranes.     

Comparative antioxidant activity of individual herbal components used in Ayurvedic medicine

Four aqueous extracts from different parts of medicinal plants used in Ayurveda (an ancient Indian Medicine) viz., Momardica charantia Linn (AP1), Glycyrrhiza glabra (AP2), Acacia catechu (AP3), and Terminalia chebula (AP4) were examined for their potential as antioxidants. The antioxidant activity of these extracts was tested by studying the inhibition of radiation induced lipid peroxidation in rat liver microsomes at different doses in the range of 100-600 Gy as estimated by thiobarbituric acid reactive substances (TBARS). Of all these extracts, AP4 showed maximum inhibition in the TBARS formation and hence is considered the best antioxidant among these four extracts. The extracts were found to restore antioxidant enzyme superoxide dismutase (SOD) from the radiation induced damage. The antioxidant capacities were also evaluated in terms of ascorbate equivalents by different methods such as cyclic voltammetry, decay of ABTS(.-) radical by pulse radiolysis and decrease in the absorbance of DPPH radicals. The results were found to be in agreement with the lipid peroxidation data and AP4 showed maximum value of ascorbate equivalents. Therefore AP4, with high antioxidant activity, is considered as the best among these four extracts.     

The role of oxygen radicals in experimental acute pancreatitis

Oxygen-derived free radicals mediate an important step in the initiation of experimental acute pancreatitis. Thereby, it seems that these reactive oxygen metabolites are generated at an early stage of disease. The source of the enhanced production of oxygen radicals still remains unclear. Experimentally, the efficiency of scavenger treatment varied between different models, whereby these differences depended on the experimental model and not on the form of pancreatitis which was induced. Most studies pretreated the experimental animals before inducing acute pancreatitis. This does not mirror the clinical reality, since patients are admitted to the hospital after onset of the disease. It was shown in Cerulein pancreatitis, however, that scavenger treatment also mitigated the pancreatic tissue damages after induction of acute pancreatitis. Moreover, antioxidant treatment also attenuated the extrapancreatic complications, thus improving the final outcome of the disease. The first indirect observations also suggest that in human acute recurrent and chronic pancreatitis, oxygen free radicals are generated and add to the damages seen. Therefore, well-defined controlled clinical studies with patients suffering from acute pancreatitis are needed to validate the role of oxygen radicals in this disease.     

Acute exposure to prion infection induces transient oxidative stress progressing to be cumulatively deleterious with chronic propagation in vitro

Neuronal loss is a pathological feature of prion diseases for which increased reactive oxygen species (ROS) and consequent oxidative stress is one proposed mechanism. The processes underlying ROS production in prion disease and the precise relationship to misfolding of the prion protein remain obscure. Using cell culture models of prion infection we found that cells demonstrate a rapid, prion protein (PrP) dependent, increase in intracellular ROS following exposure to infectious inoculum. ROS production correlated with internalisation and increased intracellular protease resistant PrP (PrP^Res). The ROS increase was predominantly lysosomal in origin but not sustained, with cells adapting within 48 hours. Overall ROS levels remained normal in the chronically prion infected cell population; however a subpopulation characterised by loss of membrane phosphatidylserine asymmetry exhibited highly peroxidised intracellular aggregates that localised with PrP and intense caspase activation. These apoptotic cells showed increased ROS closely correlating with increased PrP^Res. Our findings demonstrate that a PrP-dependent, transient, increase in intracellular ROS is characteristic of acute cellular prion infection, while chronic phases of prion infection in vitro are associated with a significant subpopulation manifesting apoptosis accompanying heightened oxidative stress and increased PrP^Res burden. Such observations strengthen the direct links between heightened ROS and ongoing prion propagation with eventual cellular demise.     

Pantothenic acid and its derivatives protect ehrlich ascites tumor cells against lipid peroxidation

Preincubation of Ehrlich ascites tumor cells at 22 or 32°C, but not at 0°C, with pantothenic acid, 4′-phosphopantothenic acid, pantothenol, or pantethine reduced lipid peroxidation (measured by production of thiobarbituric acid-reactive compounds) induced by the Fenton reaction (Fe²⁺ + H₂O₂) and partly protected the plasma membrane against the leakiness to cytoplasmic proteins produced by the same reagent. Pantothenic acid and its derivatives did not inhibit (Fe²⁺ + H₂O₂)-induced peroxidation of phospholipid multilamellar vesicles, thus indicating that their effect on the cells was not due to the scavenging mechanism. Homopantothenic acid and its 4′-phosphate ester (which are not precursors of CoA) neither protected Ehrlich ascites tumor cells against lipid peroxidation nor prevented plasma membrane leakiness under the same conditions. Incubation of the cells with pantothenic acid, 4′-phosphopantothenic acid, pantothenol, or pantethine significantly increased the amount of cellular CoA and potentiated incorporation of added palmitate into phospholipids and cholesterol esters. It is concluded that pantothenic acid and its related compounds protect the plasma membrane of Ehrlich ascites tumor cells against the damage by oxygen free radicals due to increasing cellular level of CoA. The latter compound may act by diminishing propagation of lipid peroxidation and promoting repair mechanisms, mainly the synthesis of phospholipids.     

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.