Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.     

Initiation of transcription within an RNA-polymerase binding site.

1. The 5'-terminal sequence of the RNA transcribed from bacteriophage fd replicative form DNA under the control of promotor region I has been determined to be ppp(Gp)nUpApApApGpApCpCpUpGpApUpUp. . . 2. This sequence is complementary to the 5'-terminal sequence of the minus strand of the corresponding RNA polymerase binding site I, the starting point for RNA synthesis lying approximately in the middle of the binding site. 3. This initial sequence is also transcribed faithfully from isolated complexes of RNA polymerase and binding site I, obtained by DNase digestion of complexes between RNA polymerase and fd replicative form DNA. These highly stable complexes can not be reconstituted from binding site and enzyme. 4. It is concluded that RNA polymerase binding site and initiation site are identical parts of a promoter region, and that no "drift" between these sites is required as a step in RNA chain initiation. An additional non-transcribed outside region is implicated as essential for full promoter function.