Sequence‐dependent folding and unfolding of ligand‐bound purine riboswitches

Riboswitch regulation of gene expression requires ligand‐mediated RNA folding. From the fluorescence lifetime distribution of bound 2‐aminopurine ligand, we resolve three RNA conformers (C_o, C_i, C_c) of the liganded G‐ and A‐sensing riboswitches from Bacillus subtilis. The ligand binding affinities, and sensitivity to Mg²⁺, together with results from mutagenesis, suggest that C_o and C_i are partially unfolded species compromised in key loop‐loop interactions present in the fully folded C_c. These data verify that the ligand‐bound riboswitches may dynamically fold and unfold in solution, and reveal differences in the distribution of folded states between two structurally homologous purine riboswitches: Ligand‐mediated folding of the G‐sensing riboswitch is more effective, less dependent on Mg²⁺, and less debilitated by mutation, than the A‐sensing riboswitch, which remains more unfolded in its liganded state. We propose that these sequence‐dependent RNA dynamics, which adjust the balance of ligand‐mediated folding and unfolding, enable different degrees of kinetic discrimination in ligand binding, and fine‐tuning of gene regulatory mechanisms. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 953–965, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Structural analysis of some soluble elastins by means of FT‐IR and 2D IR correlation spectroscopy

Fourier transform infrared (FT‐IR) spectroscopy combined with 2D correlation spectroscopy has been used to offer some information about stability and structure of some soluble elastins. Temperature has been chosen as the perturbation to monitor the infrared behavior of various soluble elastins, namely, α‐elastin p, α‐elastin, and k‐elastin. In the 3800–2700 cm^?1 region, the H‐containing groups were analyzed. The bonded hydroxyls are found to decrease prior to the NH‐related hydrogen bonds and also to the conformational reorganization of hydrocarbon chains. The transition temperatures were evaluated and they were found to agree with those obtained from DSC data. The FTIR spectra and their 2nd derivatives denote that α‐ elastins exhibited amide‐I, ‐II and ‐III bands at 1656, 1539 and 1236 cm^?1, respectively, while in k‐elastin these bands were found at 1652 cm^?1 for amide I, 1540 cm^?1 for amide II and 1248 cm^?1 for amide III. The macroscopic IR finger‐print method, which combines: general IR spectra, secondary derivative spectra, and 2D‐IR correlation spectra, is useful to discriminate different elastins. Thus using the differences of the position and intensity of the bands from “fingerprint region” of studied elastins, which include the peaks assigned to C?O, C? C groups from α‐helix, β‐turn, and the peaks assigned to the amide groups, it is possible to identify and discriminate elastins from each others. Furthermore, the pattern of 2D‐IR correlation spectra under thermal perturbation, allow their direct identification and discrimination. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 1072–1084, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Dynamic and structural scalings of the complexation between pDNA and bPEI in semidilute and low‐salt solutions

Using a combination of static and dynamic laser light scattering, we investigated the complexation of a supercoiled plasmid DNA (pDNA, 10⁴ bp) and a branched polyethyleneimine (bPEI, M_w = 25 kD) in semidilute and low‐salt aqueous solutions. Our results unearth some scaling laws for dynamic and structural properties of the resultant complexes (polyplexes) with different bPEI:pDNA (N:P) molar ratios. Namely, the average scattering intensity (<I>) and the average linewidth of the Rayleigh peak (<Γ>) are scaled to the scattering vector (q) as <I> ∝ q or <Γ> ∝ q, where α_S and α_D are two N:P dependent scaling exponents. The N:P ratio strongly affects the complexation. When N:P < 2.0, the motions of the negatively charged and extended pDNA chains and the polyplexes are highly correlated so that they behave like a transient network with a fractal dimension. As the N:P ratio increases, nearly all of pDNA chains condensed and the overall charge of the polyplexes reverses to slightly positive, resulting in a turbid dispersion of large loose aggregates made of smaller, but more compact, polyplexes. Further increase of N:P finally disrupts large loose aggregates, leading to a homogeneous transparent dispersion of the polyplexes. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 571–577, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

N‐terminal truncated pyroglutamyl β amyloid peptide Aβpy3‐42 shows a faster aggregation kinetics than the full‐length Aβ1‐42

We tested directly the differences in the aggregation kinetics of three important β amyloid peptides, the full‐length Aβ1‐42, and the two N‐terminal truncated and pyroglutamil modified Aβpy3‐42 and Aβpy11‐42 found in different relative concentrations in the brains in normal aging and in Alzheimer disease. By following the circular dichroism signal and the ThT fluorescence of the solution in phosphate buffer, we found substantially faster aggregation kinetics for Aβpy3‐42. This behavior is due to the particular sequence of this peptide, which is also responsible for the specific oligomeric aggregation states, found by TEM, during the fibrillization process, which are very different from those of Aβ1‐42, more prone to fibril formation. In addition, Aβpy3‐42 is found here to have an inhibitory effect on Aβ1‐42 fibrillogenesis, coherently with its known greater infective power. This is an indication of the important role of this peptide in the aggregation process of β‐peptides in Alzheimer disease. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 861–873, 2009. This article was originally published online as an accepted preprint. The “Published Online“ date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Rapid determination of antigenic epitopes in human NGAL using NMR

The recent remarkable rise in biomedical applications of antibodies and their recombinant constructs has shifted the interest in determination of antigenic epitopes in target proteins from the areas of protein science and molecular immunology to the vast fields of modern biotechnology. In this article, we demonstrated that measuring binding induced changes in two‐dimensional NMR spectra enables rapid determination of antibody binding footprints on target protein antigens. Such epitopes recognized by six high‐affinity monoclonal murine antibodies (mAbs) against human neutrophil gelatinase‐associated lipocalin (NGAL) were determined by measuring chemical shifts or broadening of peaks in ¹H‐¹⁵N‐TROSY HSQC and ¹H‐¹³C HSQC spectra of isotope‐labeled NGAL occurring upon its binding to the antibodies. Locations of the epitopes defined by the NMR studies are in good agreement with the results of antibody binding pairing observed by dual‐color fluorescence cross‐correlation spectroscopy. In all six cases, the antibodies recognize conformational epitopes in regions of relatively rigid structure on the protein. None of the antibodies interact with the more flexible funnel‐like opening of the NGAL calyx. All determined epitope areas in NGAL reflect the dimensions of respective antibody binding surface (paratopes) and contain amino acid residues that provide strong interactions. This NMR‐based approach offers comprehensive information on antigenic epitopes and can be applied to numerous protein targets of diagnostic or therapeutic interest. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 657–667, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Solvent‐dependent conformation of amylose tris(phenylcarbamate) as deduced from scattering and viscosity data

The z‐average mean‐square radius of gyration 〈S²〉_z, the particle scattering function P(k), the second virial coefficient, and the intrinsic viscosity [η] have been determined for amylose tris(phenylcarbamate) (ATPC) in methyl acetate (MEA) at 25°C, in ethyl acetate (EA) at 33°C, and in 4‐methyl‐2‐pentanone (MIBK) at 25°C by light and small‐angle X‐ray scattering and viscometry as functions of the weight‐average molecular weight in a range from 2 × 10⁴ to 3 × 10⁶. The first two solvents attain the theta state, whereas the last one is a good solvent for the amylose derivative. Analysis of the 〈S²〉_z, P(k), and [η] data based on the wormlike chain yields h (the contour length or helix pitch per repeating unit) = 0.37 ± 0.02 and λ^?1 (the Kuhn segment length) = 15 ± 2 nm in MEA, h = 0.39 ± 0.02 and λ^?1 = 17 ± 2 nm in EA, and h = 0.42 ± 0.02 nm and λ^?1 = 24 ± 2 nm in MIBK. These h values, comparable with the helix pitches (0.37–0.40 nm) per residue of amylose triesters in the crystalline state, are somewhat larger than the previously determined h of 0.33 ± 0.02 nm for ATPC in 1,4‐dioxane and 2‐ethoxyethanol, in which intramolecular hydrogen bonds are formed between the C?O and NH groups of the neighbor repeating units. The slightly extended helices of ATPC in the ketone and ester solvents are most likely due to the replacement of those hydrogen bonds by intermolecular hydrogen bonds between the NH groups of the polymer and the carbonyl groups of the solvent. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 729–736, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Complex biopolymeric systems at stalk/epicuticular wax plant interfaces: A near infrared spectroscopy study of the sugarcane example

Naturally occurring macromolecules present at the epicuticular wax/stalk tissue interface of sugarcane were investigated using near infrared spectroscopy (NIRS). Investigations of water, cellulose, and wax‐cellulose interrelationships were possible using NIRS methods, where in the past many different techniques have been required. The sugarcane complex interface was used as an example of typical phenomena found at plant leaf/stalk interfaces. This detailed study showed that sugarcane cultivars exhibit spectral differences in the CH_n, water OH, and cellulose OH regions, reflecting the presence of epicuticular wax, epidermis, and ground tissue. Spectrally complex water bands (5276 cm^?1 and 7500–6000 cm^?1) were investigated via freeze‐drying experiments which revealed sequentially a complex band substructure (7500–6000 cm^?1), a developing weak H‐bonding system (～7301 cm^?1), and strong H‐bonding (～7062 cm^?1) assigned to water—cellulose interactions. Principal component analysis techniques clarified complex band trends that developed during the desorption experiment. Bands from wax‐free stalk were minimized in the 4327–4080 cm^?1 region (C? H_n vibrational modes associated with long chain fatty compounds), while bands from the stalk tissue (particularly lignin and moisture) became more pronounced. This work is a comprehensive guide to similar studies by scientists involved in a variety of plant and fiber research fields. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 642–651, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Identification of novel peptide ligands for the cancer‐specific receptor mutation EFGRvIII using a mixture‐based synthetic combinatorial library

We report here, the design and synthesis of a positional scanning synthetic combinatorial library for the identification of novel peptide ligands targeted against the cancer‐specific epidermal growth factor tyrosine kinase receptor mutation variant III (EGFRvIII). This receptor is expressed in several kinds of cancer, in particular, ovarian, glioblastomas, and breast cancer, but not in normal tissue. The library consisted of six individual positional sublibraries in the format, H‐O_1–6XXXXX‐NH₂, O being one of the 19 proteinogenic amino acids (cysteine omitted) and X an equimolar mixture of these. The library consisted of 114 mixtures in total. Using a biotin‐streptavidin assay, the binding of each sublibrary to NR6M, NR6W‐A, and NR6 cells was tested. These cells express EGFRvIII, EGFR, and neither of the receptors, respectively. The result from each sublibrary was examined to identify the most active amino acid residue at each position. On the basis of this knowledge, eight peptides were synthesized and tested for binding to EGFRvIII. We identified one peptide, H‐FALGEA‐NH₂, that showed more selective binding to the mutated receptor than the EGFRvIII specific peptide PEPHC1. This study demonstrates the value of using mixture‐based combinatorial positional scanning libraries for the identification of novel peptide ligands targeted against the cancer‐specific EGFRvIII. Our best candidate H‐FALGEA‐NH₂ will be radioactively labeled and evaluated as an imaging agent for positron emission tomography investigation for diagnosis, staging, and monitoring of therapy of various types of cancer. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 201–206, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Mechanism of formation of the C‐terminal β‐hairpin of the B3 domain of the immunoglobulin‐binding protein G from Streptococcus. IV. Implication for the mechanism of folding of the parent protein

A 34‐residue α/β peptide [IG(28–61)], derived from the C‐terminal part of the B3 domain of the immunoglobulin binding protein G from Streptoccocus, was studied using CD and NMR spectroscopy at various temperatures and by differential scanning calorimetry. It was found that the C‐terminal part (a 16‐residue‐long fragment) of this peptide, which corresponds to the sequence of the β‐hairpin in the native structure, forms structure similar to the β‐hairpin only at T = 313 K, and the structure is stabilized by non‐native long‐range hydrophobic interactions (Val47–Val59). On the other hand, the N‐terminal part of IG(28–61), which corresponds to the middle α‐helix in the native structure, is unstructured at low temperature (283 K) and forms an α‐helix‐like structure at 305 K, and only one helical turn is observed at 313 K. At all temperatures at which NMR experiments were performed (283, 305, and 313 K), we do not observe any long‐range connectivities which would have supported packing between the C‐terminal (β‐hairpin) and the N‐terminal (α‐helix) parts of the sequence. Such interactions are absent, in contrast to the folding pathway of the B domain of protein G, proposed recently by Kmiecik and Kolinski (Biophys J 2008, 94, 726–736), based on Monte‐Carlo dynamics studies. Alternative folding mechanisms are proposed and discussed. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 469–480, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Characterization of a pectic polysaccharide from the leaves of Diospyros kaki and its modulating activity on lymphocyte proliferation

Pectin is a group of carbohydrate polymers constructing the primary cell walls and the middle lamella of terrestrial plants. Herein, we demonstrated the structure and immunomodulatory activity of the major pectic polysaccharide DL‐3B₂ isolated from the leaves of Diospyros kaki. Based on composition analysis, methylation analysis, two‐step acid hydrolysis, lithium‐mediated selective degradation, ¹³C NMR spectroscopy, and electrospray ionization mass spectrometry, DL‐3B₂ was found to contain an α‐1, 4‐linked galacturonic acid (GalA) backbone with some insertions of α‐1, 2‐linked rhamnose residues. The arabinan‐ and arabinogalactan‐side chains were attached to O‐4 of the rhamnose residues, whereas the linear arabinoxylan was probably linked to O‐3 of the GalA residues. Immunological tests in vitro showed that DL‐3B₂ could help stimulate lipopolysaccharide‐induced B lymphocyte proliferation, but not ConA‐induced T lymphocyte proliferation, and that the arabinose residues play a role in maintaining this immunological activity. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 649–656, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Biophysical characterization and unfolding of LEF4 factor of RNA polymerase from AcNPV

Late expression factor 4 (LEF4) is one of the four subunits of Autographa californica nuclear polyhedrosis virus (AcNPV) RNA polymerase. LEF4 was overexpressed in Escherichia coli and recombinant protein was subjected to structural characterization. Chemical induced unfolding of LEF4 was investigated using intrinsic fluorescence, hydrophobic dye binding, fluorescence quenching, and circular dichroism (CD) techniques. The unfolding of LEF4 was found to be a non‐two state, biphasic transition. Intermediate states of LEF4 at 2M GnHCl and 4M urea shared some common structural features and hence may lie on the same pathway of protein folding. Steady‐state fluorescence and far‐UV CD showed that while there was considerable shift in the wavelength of emission maximum (λ_max), the secondary structure of LEF4 intermediates at 2M GnHCl and 4M urea remained intact. Further, temperature induced denaturation of LEF4 was monitored using far‐UV CD. This study points to the structural stability of LEF4 under the influence of denaturants like urea and temperature. Although LEF4 is an interesting model protein to study protein folding intermediates, in terms of functional significance the robust nature of this protein might reflect one of the several strategies adapted by the virus to survive under very adverse environmental and physiological conditions. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 574–582, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Comparison of the internalization of targeted dendrimers and dendrimer‐entrapped gold nanoparticles into cancer cells

Dendrimer‐based nanotechnology significantly advances the area of targeted cancer imaging and therapy. Herein, we compared the difference of surface acetylated fluorescein isocyanate (FI) and folic acid (FA) modified generation 5 (G5) poly(amidoamine) dendrimers (G5.NHAc‐FI‐FA), and dendrimer‐entrapped gold nanoparticles with similar modifications ([(Au⁰)_51.2‐G5.NHAc‐FI‐FA]) in terms of their specific internalization to FA receptor (FAR)‐overexpressing cancer cells. Confocal microscopic studies show that both G5.NHAc‐FI‐FA and [(Au⁰)_51.2‐G5.NHAc‐FI‐FA] exhibit similar internalization kinetics regardless of the existence of Au nanoparticles (NPs). Molecular dynamics simulation of the two different nanostructures reveals that the surface area and the FA moiety distribution from the center of the geometry are slightly different. This slight difference may not be recognized by the FARs on the cell membrane, consequently leading to similar internalization kinetics. This study underlines the fact that metal or inorganic NPs entrapped within dendrimers interact with cells in a similar way to that of dendrimers lacking host NPs. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 936–942, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Helix‐coil energetics for helix formers and breakers reflect context and temperature: Mutants of helically robust,guest‐sensitive homopeptide hosts

The natural amino acids are primarily helix breakers at the low assignment temperatures characteristic of many studies, but recent genomic analyses of thermophilic proteins suggest that at high temperatures, some breakers may become strong helix formers. Moreover, the breaker/former inventory has not been previously characterized at the physiologically relevant temperature of 37°C. The versatility of ¹³C?O NMR chemical shifts as helicity reporters allows construction of two mutant peptide series, tailored to expand the range of temperature assignments for helical propensities and derived from the core hosts ^tL‐Ala₉XxxAla₉‐^tL and ^tL‐AlaNva₄XxxNva₄Ala₉‐^tL, Nva = norvaline. For three limiting guests Xxx, the helix former Nva and the breakers Gly and Pro, we report w_Xxx[T] assignments at seven temperatures from 2 to 80°C, validating our reasoning and paving the way for assignment of a definitive w_Xxx[T] data‐base. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 311–320, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Conformational evaluation of labeled C3′‐O‐P‐13CH2‐O‐C4″ phosphonate internucleotide linkage,a phosphodiester isostere

Modified internucleotide linkage featuring the C3′‐O‐P‐CH₂‐O‐C4″ phosphonate grouping as an isosteric alternative to the phosphodiester C3′‐O‐P‐O‐CH₂‐C4″ bond was studied in order to learn more on its stereochemical arrangement, which we showed earlier to be of prime importance for the properties of the respective oligonucleotide analogues. Two approaches were pursued: First, the attempt to prepare the model dinucleoside phosphonate with ¹³C‐labeled CH₂ group present in the modified internucleotide linkage that would allow for a more detailed evaluation of the linkage conformation by NMR spectroscopy. Second, the use of ab initio calculations along with molecular dynamics (MD) simulations in order to observe the most populated conformations and specify main structural elements governing the conformational preferences. To deal with the former aim, a novel synthesis of key labeled reagent (CH₃O)₂P(O)¹³CH₂OH for dimer preparation had to be elaborated using aqueous ¹³C‐formaldehyde. The results from both approaches were compared and found consistent. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 514–529, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

“Setting paint” analogy for the hydrophobic self‐association of tropoelastin into elastin‐like hydrogel

Alkaline tropoelastin solutions (pH 11) were optically clear at low temperatures, but a firm gel formed when the temperature was raised to 37°C. Reversion to a clear solution took place if the temperature was lowered to below 20°C within less than 2 h, but not if 37°C was maintained for several hours. The precipitated elastin‐like hydrogel thus formed did not visually redissolve at low temperatures. Tropoelastin hydrogel was stable to subsequent washings with alkaline solution at 37°C, but at 4°C some hydrogel redissolved showing that association is at least partly reversible. Washing the hydrogel with neutral 8M urea solution at 4°C dissolved less than 10% of tropoelastin in 24 h. We characterized this phenomenon by combining temperature‐controlled light microscopy analysis, ¹H NMR spectroscopy (temperature, diffusion, and relaxation time studies), and UV‐absorption‐based concentration measurements. The self‐association of tropoelastin at pH 11 is due to hydrophobic interactions in an emulsion‐like system in which the spherules coalesce in a manner like a water‐based latex paint that forms a durable hydrophobic sheet as water and the organic solvent evaporate. In the present case, the sedimentation and entanglement of the tropoelastin porous sheets means that reverse dissolution is a kinetically slow process. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 321–330, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Inhibition of yes‐associated protein suppresses brain metastasis of human lung adenocarcinoma in a murine model

Yes‐associated protein (YAP) is a main mediator of the Hippo pathway and promotes cancer development and progression in human lung cancer. We sought to determine whether inhibition of YAP suppresses metastasis of human lung adenocarcinoma in a murine model. We found that metastatic NSCLC cell lines H2030‐BrM3(K‐ras^G12C mutation) and PC9‐BrM3 (EGFR^Δexon19 mutation) had a significantly decreased p‐YAP(S127)/YAP ratio compared to parental H2030 (K‐ras^G12C mutation) and PC9 (EGFR^Δexon19 mutation) cells (P < .05). H2030‐BrM3 cells had significantly increased YAP mRNA and expression of Hippo downstream genes CTGF and CYR61 compared to parental H2030 cells (P < .05). Inhibition of YAP by short hairpin RNA (shRNA) and small interfering RNA (siRNA) significantly decreased mRNA expression in downstream genes CTGF and CYR61 in H2030‐BrM3 cells (P < .05). In addition, inhibiting YAP by YAP shRNA significantly decreased migration and invasion abilities of H2030‐BrM3 cells (P < .05). We are first to show that mice inoculated with YAP shRNA‐transfected H2030‐BrM3 cells had significantly decreased metastatic tumour burden and survived longer than control mice (P < .05). Collectively, our results suggest that YAP plays an important role in promoting lung adenocarcinoma brain metastasis and that direct inhibition of YAP by shRNA suppresses H2030‐BrM3 cell brain metastasis in a murine model.     

Heating‐induced conformational change of a novel β‐(1→3)‐D‐glucan from Pleurotus geestanus

Recently, we isolated and purified a neutral polysaccharide (PGN) from edible fungus Pleurotus geestanus. Its structure was characterized by a range of physical–chemical methods, including high performance anion exchange chromatography, uronic acid, and protein analyses, size exclusion chromatography with ultraviolet, refractive index and light scattering detectors, and nuclear magnetic resonance. Our results revealed that PGN is a novel β‐(1→3)‐D ‐glucan with glucose attached to every other sugar residues at Position 6 in the backbone. It has a degree of branching of 1/2. Such structure is different from typical β‐(1→3)‐D ‐glucans schizophyllan and lentinan in which DB is 1/3 and 2/5, respectively. Rheological study showed a very interesting melting behavior of PGN in water solution: heating PGN in water leads to two transitions, in the range of 8–12.5°C and 25–60°C, respectively. The melting behavior and conformational changes were characterized by rheometry, micro‐differential scan calorimetry, atomic force microscopy, static and dynamic light scattering at different temperatures. The first heating‐induced transition corresponds to the disintegration of polymer bundles into small helical clusters, resembling the heating‐induced dissociation of SPG in water at 7°C; the second one might correspond to the dissociation of helical strands to individual chains. The ability of PGN to undergo a conformation/viscosity transition in water upon heating is very valuable to immobilize cells or enzymes or therapeutic DNA/RNA, which makes PGN a potentially useful biomaterial. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 121–131, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Glycerol‐induced folding of unstructured disulfide‐deficient lysozyme into a native‐like conformation

2SS[6‐127,64‐80] variant of lysozyme which has two disulfide bridges, Cys6‐Cys127 and Cys64‐Cys80, and lacks the other two disulfide bridges, Cys30‐Cys115 and Cys76‐Cys94, was quite unstructured in water, but a part of the polypeptide chain was gradually frozen into a native‐like conformation with increasing glycerol concentration. It was monitored from the protection factors of amide hydrogens against H/D exchange. In solution containing various concentrations of glycerol, H/D exchange reactions were carried out at pH* 3.0 and 4°C. Then, ¹H‐¹⁵N‐HSQC spectra of partially deuterated protein were measured in a quenching buffer for H/D exchange (95% DMSO/5% D₂O mixture at pH* 5.5 adjusted with dichloroacetate). In a solution of 10% glycerol, the protection factors were nearly equal to 10 at most of residues. With increasing glycerol concentration, some selected regions were further protected, and their protection factors reached about a 1000 in 30% glycerol solution. The highly protected residues were included in A‐, B‐, and C‐helices and β3‐strand, and especially centered on Ile 55 and Leu 56. In 2SS[6‐127,64‐80], long‐range interactions were recovered due to the preferential hydration by glycerol in the hydrophobic box of the α‐domain. Glycerol‐induced recovering of the native‐like structure is discussed from the viewpoint of molten globules growing with the protein folding. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 665–675, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Single‐molecule pair studies of the interactions of the α‐GalNAc (Tn‐antigen) form of porcine submaxillary mucin with soybean agglutinin

Mucins form a group of heavily O‐glycosylated biologically important glycoproteins that are involved in a variety of biological functions, including modulating immune response, inflammation, and adhesion. Mucins are also involved in cancer and metastasis and often express diagnostic cancer antigens. Recently, a modified porcine submaxillary mucin (Tn‐PSM) containing GalNAcα1‐O‐Ser/Thr residues was shown to bind to soybean agglutinin (SBA) with ～10⁶‐fold enhanced affinity relative to GalNAcα1‐O‐Ser, the pancarcinoma carbohydrate antigen. In this study, dynamic force spectroscopy is used to investigate molecular pairs of SBA and Tn‐PSM. A number of force jumps that demonstrate unbinding or rebinding events were observed up to a distance equal to 2.0 μm, consistent with the length of the mucin chain. The unbinding force increased from 103 to 402 pN with increasing force loading rate. The position of the activation barrier in the energy landscape of the interaction was 0.1 nm. The lifetime of the SBA–TnPSM complex in the absence of applied force was determined to be in the range 1.3–1.9 s. Kinetic parameters describing the rate of dissociation of other sugar lectin interactions are in the range 3.3 × 10^?3–2.5 × 10^?3 s. The long lifetime of the SBA‐TnPSM complex is compatible with a binding model in which lectin molecules “bind and jump” from α‐GalNAc residue to α‐GalNAc residue along the polypeptide chain of Tn‐PSM before dissociating. These findings have important implications for the molecular recognition properties of mucins. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 719–728, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com