The regulatory region of MS2 phage RNA replicase cistron. Functional activity of individual MS2 RNA fragments

The present work deals with the structural-functional organization of regulatory regions of messenger RNAs. Some principles of the action of a translational repressor (coat protein) and the formation of the ribosomal initiation complex at the replicase cistron have been studied with MS2 phage RNA. When the complex of MS2 RNA with the coat protein is treated with T₁ ribonuclease, the coat protein selectively protects mainly two fragments (59 and 103 nucleotides in length) from digestion; these fragments contain the intercistronic regulatory region and the beginning of the MS2 replicase cistron. These polynucleotides have been isolated in a pure state and their primary structure has been established.It has been established that both MS2 RNA fragments contain all the necessary information for specific interaction with MS2 coat protein and form a complex with it with an efficiency close to that observed in the case of native MS2 RNA. They also provide the normal polypeptide chain initiation at the replicase cistron. Enzymatic binding of the second aminoacyl-tRNA and electrophoretic analysis of N-terminal dipeptides prove that only the true initiator codon of the replicase cistron is recognized by a ribosome despite the presence of a few additional AUG triplets within the polynucleotides. Under conditions of limited hydrolysis by T₁ ribonuclease, the beginning of the replicase cistron has been removed from the shortest polynucleotide leading to a complete loss of its ability to bind both the coat protein and a ribosome.Some principles of the functioning of the regulatory region in MS2 RNA as well as the nature of the initiator signal of protein biosynthesis are discussed.     

The regulatory region of phage fr replicase cistron. III. Initiation activity of specific fr RNA fragments.

RNA fragments from phage fr covering the complete or part of the replicase cistron initiation region have been used as templates in the formation of a ribosomal initiation complex in vitro. The results so obtained together with our earlier findings in a similar approach applied to fragments of the structurally related RNA from phage MS2 have allowed us to pinpoint the boundaries of the replicase cistron initiation region on phage RNA. A structural model of the above initiation region has been provided which shows that besides the minimal initiation region (comprises the Shine-Dalgarno sequence and initiator AUG), the flanking regions are also involved and are responsible for additional interactions with the ribosome. The flanking regions possibly contribute to the stability of specific contact between the ribosome and template realized by the minimal initiation region.     

The regulatory region of MS2 phage RNA replicase cistron. IV. Functional activity of specific MS2 RNA fragments in formation of the 70 S initiation complex of protein biosynthesis.

The initiation region of the MS2 replicase cistron can be isolated as a fragment 59 bases in length protected from RNAase by the binding of the coat protein which serves as a translational repressor. This fragment MS2 R(-53 leads to 6) starts 53 bases before the initiation codon and retains full activity in binding ribosomes. We have investigated the functional activity in initiation of a series of fragments from this region variously shortened from the 5'-end. Ribosome protected fragments starting 17 or 21 bases before the AUG are unable to rebind to ribosomes. The shortest fragment which has this activity was produced by partial S1 nuclease digestion and starts 33 to 35 bases before the AUG. The initiation signal comprises some nucleotides between 21 and 33 bases before the initiation codon and the regulatory region responsible for initiation is longer than that protected by the ribosome in the final initiation complex.     

Regulatory region of fr phage replicase cistron. II. Isolation and structure of specific fr RNA fragments

A new set of short RNA templates has been prepared for functional studies in initiation of translation in vitro. Number of individual RNA fragments which contain complete or part of the initiatory region of phage fr replicase cistron were isolated from complex fr RNA--fr coat protein. Their primary structure were determined by using standard fingerprint technique and rapid gel sequencing. Secondary structure of several RNA fragments and their binding activity with phage fr and MS2 coat proteins has been also studied.     

Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.     

Comparison of the conformation of RNA from phage MS2 and 16S rRNA. Interaction with dyes specific for the secondary structure of native RNA and RNA subjected to hydrolysis by nuclease S1

The interaction of ethidium bromide (EtBr) with double-stranded (ds), and acridine orange (AO) with single-stranded (ss) fragments of 16S rRNA Escherichia coli in a wide range of ionic strength, at various pH, Zn2+ ion concentrations and partial hydrolysis by nuclease S1 was investigated. It was shown that about 90% of the RNA molecule is accessible to both dyes, when the ionic strength is near of 0.01 (pH 7). Approximately half of the RNA becomes inaccessible to dyes, when the ionic strength was increased up to 0.08-0.24 (pH 4.7-7), independent on the presence of Zn2+ ions (10(-3) M). About a half of the ds-, and a quarter of the ss-segments of the RNA, deduced from the secondary structure model were protected from the interaction with EtBr and AO. The hydrolysis of about a half of ss-segments upon addition of the Zn2+ (10(-3) M) ions did not affect the RNA tertiary structure. The experimental data obtained confirm the idea of the existence of some "nucleus" (or "nuclei") within the 16S rRNA molecule. The "nucleus" seems to be inaccessible to the dyes and is very stable to heat denaturation. It was supposed that this structure is organized by means of interaction of some of the parallelly oriented ds-segments, as it was suggested earlier for the phage MS2 RNA structure.     

Characterisation of RNA fragments obtained by mild nuclease digestion of 30-S ribosomal subunits from Escherichia coli.

When Escherichia coli 30-S ribosomal subunits are hydrolysed under mild conditions, two ribonucleoprotein fragments of unequal size are produced. Knowledge of the RNA sequences contained in these hydrolysis products was required for the experiments described in the preceding paper, and the RNA sub-fragments have therefore been examined by oligonucleotide analysis. Two well-defined small fragments of free RNA, produced concomitantly with the ribonucleoprotein fragments, were also analysed. The larger ribonucleoprotein fragment, containing predominantly proteins S4, S5, S8, S15, S16 (17) and S20, contains a complex mixture of RNA sub-fragments varying from about 100 to 800 nucleotides in length. All these fragments arose from the 5'-terminal 900 nucleotides of 16-S RNA, corresponding to the well-known 12-S fragment. No long-range interactions could be detected within this RNA region in these experiments. The RNA from the smaller ribonucleoprotein fragment (containing proteins S7, S9 S10, S14 and S19) has been described in detail previously, and consists of about 450 nucleotides near the 3' end of the 16-S RNA, but lacking the 3'-terminal 150 nucleotides. The two small free RNA fragments (above) partly account for these missing 150 nucleotides; both fragments arose from section A of the 16-S RNA, but section J (the 3'-terminal 50 nucleotides) was not found. This result suggests that the 3' region of 16-S RNA is not involved in stable interactions with protein.     

Caffeine enhancement of digestion of DNA by nuclease S1.

The activity of Aspergillus orzae nuclease S1 on DNA has been investigated under varying pH and metal ion conditions. Nuclease S1 was found to preferentially digest denatured DNA. With native DNA as substrate the enzyme could only digest the DNA when caffeine was added to the reaction mixture. The enzyme was more active in sodium acetate buffer (pH 4.5), than in either standard saline citrate (PH 7.0) or sodium phosphate buffer (pH 6.8). Caffeine was also found to affect the thermal stability of DNA, resulting in a melting profile characterized by two transitions. The first transition (poorly defined) was below the normal melting temperature of the DNA, while the next transition was at the normal melting temperature of the DNA, while the next transition was at the normal melting temperature of the DNA. The susceptibility of caffeine-treated DNA to nuclease digestion seems to be a result of the local unwinding that caffeine causes in the regions of DNA that melt in the first transition. This selective destabilization presumably sensitizes the unwound regions to nuclease hydrolysis. The hydrolysates of the DNA digested by nuclease S1 were subjected first to ion exchange chromatography followed by paper chromatography. The results from this partial characterization of the digestion products showed that they contain mononucleotides as well as oligonucleotides of varying lengths. The base composition of the mononucleotide digests suggests that caffeine has greater preference for interacting with A-T base-pairs in DNA.     

Structure and function of 5S ribosomal ribonucleic acid from Torulopsis utilis. III. Detection of single-stranded regions by digestion with nuclease S1

Identification of single-stranded regions in Torulopsis utilis 5S RNA was attempted by the use of Nuclease S1, a single-strand specific endonuclease. When T. utilis 5S RNA was subjected to prolonged incubation with Nuclease S1, about 50% of the substrate 5S RNA remained as large oligonucleotide "cores." Such Nuclease S1-resistant fragments were purified and sequenced by column chromatographic procedures. These analyses revealed that regions around positions 12, 40, 57, and 110 are in exposed single-stranded loops at 37 degrees C and that regions around positions 12 and 40 are most exposed at 20 degrees C. These results are compatible with our secondary structure model for T. utilis 5S RNA (Nishikawa & Takemura (1974) J. Biochem. 76, 935-947) except that the 5' part of the molecule (from the region around position 22 to that around position 57) might have a somewhat looser conformation than our secondary structure model suggests. The implications of such results are also discussed in relation to the presumed function of the sequence C-G-A-U-C (around position 40) as one of the recognition sites for initiator tRNA binding on ribosomes.     

Codon usage and secondary structure of MS2 phage RNA.

MS2 is an RNA bacteriophage (3569 bases). The secondary structure of the RNA has been determined, and is known to play an important role in regulating translation. Paired regions of the genome have a higher G+C content than unpaired regions. It has been suggested that this reflects selection for high G+C content to encourage pairing, but a re-analysis of the data together with computer simulation suggest that it is an automatic consequence in any RNA sequence of the way it folds up to minimise its free energy. It has also been suggested that the three registers in which pairing can occur in a coding region are used differentially to optimise the use of the redundancy of the genetic code, but re-analysis of the data shows only weak statistical support for this hypothesis.     

Isolation of foldback DNA utilizing nuclease S1 digestion in aqueous dioxane.

An improved method for the isolation of the inverted repetitive (foldback) sequences present in mammalian DNAs is described. It makes use of the new observation that nuclease S1 digestion of denatured DNA occurred at a faster rate and was more extensive in medium containing dioxane. The temperature-absorbance characteristics of nuclease S1-resistant DNA were systematically studied as a function of the temperature employed during the step of enzymic hydrolysis. Specimens of human placental and calf thymus DNA which had been denatured and renatured to C₀t ≤ 10^?3 mol s liter^?1 were used as substrates. Foldback DNA was isolated from the enzymic digests by means of hydroxylapatite chromatography. Temperature-absorbance studies showed the enzyme-resistant DNA had a high degree of thermal stability; the hyperchromic rises equaled those obtained in the native speciments. The amount of foldback DNA which could be obtained was not influenced by the fragment size of the starting material, above a certain molecular weight range. Foldback DNA represented about 4% of the human genome and at least 5% of the bovine genome. The size distributions of these strands were studied by means of polyacrylamide gel electrophoresis.     

Sites hypersensitive to, and protected from, nuclease digestion in the regulatory region of wild-type and mutant polyoma chromatin.

It has been shown that the untranscribed regulatory region of polyoma virus (Py) is hypersensitive (Hs) to DNase I treatment, and that this hypersensitivity is located in two areas which correspond to the A and B domains of the enhancer. We mapped the DNase I hypersensitive sites in the Py regulatory region of wild-type (PyA2) and of mutants, selected in neuroblastoma cells (PyNB), which are characterized by an extensive duplication involving the A domain, with or without deletion of the B domain. The experiments were performed in both a permissive host (3T6 mouse fibroblasts) and in a restrictive host (41A3 mouse neuroblasts). No significant differences were observed between the two hosts. Our results show that four sites, in addition to the ones already described, can be identified in the wild-type A2 strain. These newly identified sites coincide with the domains of the enhancer region as they have recently been established. In PyNB mutants duplications and deletions are generally correlated to the gain or loss of the corresponding hypersensitive sites. However, a new site is formed in one of the duplicated sequences, even if no corresponding hypersensitive site is present in the other identical sequence. A region protected from DNase I digestion occurs in the PyNB mutants which corresponds to the junction of the duplication which is absent in the wild-type strain. In this region, as a consequence of the rearrangement, a GGCGGG motif which is very similar to the one (GGGCGG) present at the binding sites of the cellular regulatory protein SP1, is found.(ABSTRACT TRUNCATED AT 250 WORDS)     

S1 nuclease as a probe of yeast ribosomal 5 S RNA conformation.

5 S RNA was isolated from Saccharomyces cerevisiae grown in the presence of 32P-phosphate and digested with nuclease S1, a single-strand specific nuclease. Two different procedures were employed to determine the sites of attack on the RNA. First, 5 S RNA was isolated from nuclease S1 digests, digested to completion with ribonuclease T1, and then 'fingerprinted' by two-dimensional electrophoresis. Quantitation of each of the characteristic RNAase T1-derived oligonucleotides was employed to determine the relative susceptibility of various regions of the molecule to nuclease S1. A second procedure to define nuclease S1-susceptible sites in the molecule employed polyacrylamide gel electrophoretic fractionation of nuclease S1 digests followed by identification of the nucleotide sequences of the released RNA fragments. Both procedures showed that the region of the molecule between residues 9 and 60 was most susceptible to nuclease S1, with preferential cleavage occurring between residues 12-25 and 50-60. These results are discussed in relation to a proposed model for the secondary structure of yeast 5 S RNA.