Analysis of genetic diversity in Phytophthora colocasiae causing leaf blight of taro (Colocasia esculenta) using AFLP and RAPD markers

The oomycetous fungus Phytophthora colocasiae that causes taro leaf blight is one of the most devastating diseases of taro and is widely distributed in India. Molecular and cultural techniques were employed for assessing and exploiting the genetic variability among isolates of P. colocasiae obtained from different geographical regions of India. Analysis of the 5.8-ITS region revealed detectable intraspecific variation among isolates. Ten random amplified polymorphic DNA (RAPD) and eight amplified fragment length polymorphism (AFLP) primers produced 198 and 510 reproducible fragments, respectively. AFLP produced 100 % polymorphism, whereas RAPD showed 93.5 % polymorphism. The average value of the number of observed alleles, the number of effective alleles, mean Nei’s genetic diversity, and Shannon’s information index were 2.00–1.94, 1.53–1.36, 0.31–0.24, and 0.47–0.40, respectively, for two DNA markers used. Analysis of molecular variance (AMOVA) for both markers produced similar results with the majority (85 %, AFLP; 89 %, RAPD) of the diversity present within population of P. colocasiae. Dendrograms based on two molecular data using the unweighted pair group method with arithmetic mean (UPGMA) was incongruent and classified the P. colocasiae isolates into one and two major clusters. Cophenetic correlation coefficient between dendrogram and original similarity matrix were significant for RAPD (r?=?0.904) and AFLP (r?=?0.825). The results of this study displayed a high level of genetic variation among the isolates irrespective of the geographical origin. The possible mechanisms and implications of this genetic variation are discussed.     

Sequence related amplified polymorphism (SRAP) analysis for genetic diversity and micronutrient content among gene pools in mungbean [Vigna radiata (L.) Wilczek]

Vigna radiata (L.) Wilczek, commonly called mungbean is an important pulse crop. Commercial cultivars contain low levels of iron and zinc and it is important to assess genetic variability in the available germplasm for improving micronutrient content in commercial cultivars. The present study was undertaken to study molecular diversity using Sequence-related amplified polymorphism (SRAP) among 21 Vigna radiata genotypes. Twenty nine SRAP primer combinations produced a total of 121 amplified bands which were polymorphic with an average of 4.65 bands per primer. The size of amplified bands ranged from 70 bp to 3,000 bp and 6 out of 29 SRAP primers were most useful in fingerprinting Vigna radiata genotypes under study. The similarity coefficients between different genotypes ranged from 0.45 to 0.96 with an average similarity value of 0.71. At an arbitrary cut-off at 60 % similarity level on a dendrogram, the Vigna radiata accessions were categorized into two major clusters. ML1108 and 2KM115 were found to be genetically similar. SMH99-1A and ML776 showed high iron and zinc content while Satya was poor in iron as well as zinc content. Mapping population involving ML776 and Satya could be used for tagging gene(s) for micronutrient content. The results indicated that SRAP markers were efficient for identification of Vigna radiata genotypes and assessment of the genetic relationships among them.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Genotyping Assessment of Phosphate Solubilizing Bacteria Isolated from Rhizospheric Soil from Central Regions of Lucknow

Abstract

Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous (P) to an available form which is a major concern in Indian agriculture. In this study, 21 isolates having phosphate solubilizing capability were isolated from different regions of Lucknow, India. Among all, six efficient PSB were confirmed by using in vitro P estimation and 16S rRNA universal primers. The similarity detection was done using random amplified polymorphic DNA (RAPD) finger printing for genotyping the PSB isolates and to determine genetic relatedness between them. Twenty different OPA primers were tested among which four primers produced prominent, highly reproducible, and polymorphic bands. An average of 10.5 polymorphic bands per primer with the amplified DNA fragments ranging from 200 to 2000?bp in size. A dendrogram constructed from these data indicated 25–76% homology. Highest similarity was found in between Bacillus anthracis and Bacillus cereus with 33.8% similarity while least dissimilarity was found in B. anthracis and Pseudomonas fragi with 12% of similarity. These findings provide that there is a great genetic diversity between bacterial isolates from different geographical regions and RAPD can be used as a specific, time consuming and also proves as a reliable molecular tool which helps in strain level discrimination.     

Vibriostatic effects of probiotic Bacillus licheniformis Dahb1 and its molecular phylogeny resolved through RAPD markers

The in vitro vibriostatic effects of probiotic Bacillus licheniformis strains (Dahb1 to Dahb7) from both wild and commercial sources were evaluated against pathogenic Vibrios isolated from shrimp hatcheries and farms. Agar antagonism assay results showed that, out of seven B. licheniformis strains, strain Dahb1 showed the biggest inhibitory zone (6–12 mm) tested against 162 isolates of Vibrio spp. viz., V. harveyi (53 isolates), V. anguillarum (42 isolates), V. vulnificus (31 isolates) and Photobacterium damselae ssp. damselae (36 isolates) obtained from Penaeus monodon culture hatcheries and ponds. The genetic status of these seven strains were analyzed through randomly amplified polymorphic DNA analysis using 18 random primers. Of the 18 primers studied, only 6 generated repeatable polymorphic DNA bands with sizes ranging from 250 to 1,000 bp in seven isolates of B. licheniformis. The dendrogram generated from resolved gel profiles showed two major branches with three clusters. The results of the present study allow us to conclude that B. licheniformis Dahb1 can be used as an effective probiotic to control Vibrios. Field studies are needed to evaluate probiotic efficiency to control diseases in aquatic organisms.     

Bioprospecting for genes involved in the production of chitosanases and microcystin-like compounds in Anabaena strains

Bioinformatic tools guided PCR amplification assays were employed for analyzing two Anabaena strains A. laxa and A. iyengarii which exhibited chitosanase activity, allelopathic and fungicidal activity. Sequencing of a 297 bp fragment obtained by amplification with primers directed towards mcy A gene (involved in the production of microcystins), revealed significant similarity with the condensation domain, while amplification with specific primers towards N-methyltransferase (NMT) domain showed 59% similarity with a homologous domain in a toxic strain of Microcystis aeruginosa. An amplified product of 172 bp obtained using specific primers derived from the coding region of chitinase (chi IS) gene in Streptomyces sp., showed 100% similarity with hydrogenbyrinic acid a, c-diamide cobaltochelatase gene in Anabaena, and significant similarity with chi IS gene of Streptomyces sp. under less stringent conditions. The 663 bp sequence obtained by employing specific primers for chitosanase (choA) derived from Mitsuaria chitosanitabida 3001 strain, showed 100% similarity with glycoside hydrolase family three domain like protein(s). This study is a first time report on the presence of homologues of chitosanase in cyanobacteria which can play a role in allelopathic activity exhibited by these oxygenic photosynthetic prokaryotes.     

Development of a SCAR marker for molecular detection and diagnosis of Tilletia controversa Kühn,the causal fungus of wheat dwarf bunt

Tilletia controversa Kühn (TCK) is an important quarantine pathogen that causes wheat dwarf bunt and results in devastating damage to wheat production. The fungus is difficult to be distinguished from T. caries and T. laevis, which cause wheat common bunt, based on morphological, physiological and symptomatological characteristics of the pathogens. The traditional detection of the fungus can be a long and tedious process with poor accuracy. The inter-simple sequence repeat (ISSR) technique has been used for identifying molecular markers for detection of TCK. Of 28 ISSR primers screened, ISSR-859 amplified a specific 678 bp DNA fragment from all TCK isolates but not from any isolates of the common bunt fungi or other pathogenic fungi tested. Based on the fragment sequence, a pair of sequence characterized amplified region (SCAR) primers was designed, which amplified a 372 bp DNA fragment specifically in TCK. The SCAR marker was detected using as low as 1 ng template DNA of TCK, and was also detected using broken teliospores and DNA from asymptomatic wheat samples. We developed the SYBR Green I and TaqMan Green I and TaqMan real-time polymorphism chain reaction methods to detect TCK with the detection limit of 0.1 fg with asymptomatic wheat samples. Further work is needed to develop a rapid test kit for this pathogenic fungus using the designed specific primers.     

Quick and accurate detection of <Emphasis Type="Italic">Fusarium oxysporum</Emphasis> f. sp. <Emphasis Type="Italic">carthami</Emphasis> in host tissue and soil using conventional and real-time PCR assay

Safflower wilt, caused by Fusarium oxysporum f. sp. carthami (Foc) is a major limiting factor for safflower (Carthamus tinctorius) production worldwide. In India alone, about 40–80% disease incidence has been reported. A rapid, efficient, specific, and sensitive diagnostic technique for Foc is therefore crucial to manage Fusarium wilt of safflower. Twenty-five isolates of F. oxysporum formae speciales infecting other crops, 17 isolates of Fusarium spp. and seven isolates of other fungal pathogens of safflower along with 75 Foc isolates were used for identification of band specific to Foc using inter-simple sequence repeat (ISSR) analysis. Out of 70 ISSR primers, the one that specifically amplified a 490 bp fragment from all the Foc isolates was selected. Sequence of the amplified fragment was utilized to design sequence characterized amplified region (SCAR) primers (FocScF/FocScR). The primer pair unambiguously and exclusively amplified a DNA fragment of approximately 213 bp in all the 75 Foc isolates. The primer set was able to detect as low as 10 pg of Foc genomic DNA using conventional PCR, while the SCAR primers when coupled with real-time qPCR demonstrated detection limits of 1 pg for Foc genomic DNA and 1000 conidia/g for soil. The assay enabled reliable diagnosis of Foc DNA in contaminated safflower fields and expedited Foc detection at 72 h post inoculation in asymptomatic seedlings. This method facilitates quick and precise detection of Foc in plant and soil samples and can be exploited for timely surveillance and sustainable management of the disease.     

Detection of genetic variability in various isolates of cattle tick, <Emphasis Type="Italic">Boophilus microplus</Emphasis> from Tamil Nadu,India using PCR-RAPD analysis

The genomic DNA from ten isolates of the cattle tick, Boophilus microplus collected in and around Chennai, India, was analyzed by random amplified polymorphic DNA (RAPD) using PCR. Selected five random primers were used for the study of genetic variability among different isolates of B. microplus. A high degree of genetic polymorphism with a different pattern of RAPD profiles for each tick isolate was detected with all these random primers. This variability was also confirmed by similarity coefficient values and dendrogram which were performed using mean RAPD profiles for all the primers between various isolates of ticks. The findings suggest the existence of a complex genotypic diversity of the tick B. microplus in an endemic region such as Chennai.     

Diversity,molecular phylogeny and fingerprint profiles of airborne <Emphasis Type="Italic">Aspergillus</Emphasis> species using random amplified polymorphic DNA

In the present study, diversity and phylogenetic relationship of Aspergillus species isolated from Tehran air was studied using random amplified polymorphic DNA (RAPD)–polymerase chain reaction (RAPD-PCR). Thirty-eight Aspergillus isolates belonging to 12 species i.e. A. niger (28.94 %, 11 isolates), A. flavus (18.42 %, 7 isolates), A. tubingensis (13.15 %, 5 isolates), A. japonicus (10.52 %, 4 isolates), A. ochraceus (10.52 %, 4 isolates), and 2.63 %, 1 isolate from each A. nidulans, A. amstelodami, A. oryzae, A. terreus, A. versicolor, A. flavipes and A. fumigatus were obtained by settle plate method which they were distributed in 18 out of 22 sampling sites examined. Fungal DNA was extracted from cultured mycelia of all Aspergillus isolates on Sabouraud Dextrose Agar and used for amplification of gene fragments in RAPD-PCR using 11 primers. RAPD-PCR data was analyzed using UPGMA software. Resulting dendrogram of combined selected primers including PM1, OPW-04, OPW-05, P160, P54, P10 and OPA14 indicated the distribution of 12 Aspergillus species in 8 major clusters. The similarity coefficient of all 38 Aspergillus isolates ranged from 0.02 to 0.40 indicating a wide degree of similarities and differences within and between species. Taken together, our results showed that various Aspergillus species including some important human pathogenic ones exist in the outdoor air of Tehran by different extents in distribution and diversity and suggested inter- and intra-species genetic diversity among Aspergillus species by RAPD-PCR as a rapid, sensitive and reproducible method.     

Genetic similarity among cultivars of Phyllostachys pubescens

Phyllostachys pubescens is the most important economic bamboo species in China, which grows widely in the South of China. There are more than ten cultivars in this species but their genetic relationship still remains unknown. We used both amplified fragment length polymorphism (AFLP) and inter-simple sequence repeat (ISSR) techniques to determine genetic similarity among ten cultivars of P. pubescens and two related species. Eight hundred and twenty seven bands, in which 495 are polymorphic, were detected using 15 pairs of AFLP primers whereas total 231 bands, in which 154 bands are polymorphic, were scored using 16 ISSR primers. Statistic analysis showed that the genetic similarity matrices obtained from these two sets of molecular markers had a significant correlation (R = 0.959, P = 0.013). The dendrogram generated with AFLP and ISSR markers could clearly genetically identify ten cultivars of P. pubescens that had high similarity with genetic distances ranging from 0.023 to 0.108, and could be divided into three groups based on their genetic variation and similarity. Our results suggest that these molecular markers are useful to genetically classify cultivars or varieties of a species, particularly a bamboo species.     

Determination of variability in monosporidial lines of Tilletia indica by RAPD analysis

Genetic variability in 23 monosporidial lines developed from five isolates of Tilletia indica causing Karnal bunt of wheat isolated from four wheat growing states of India was determined by using 19 rapid amplified polymorphic DNA (RAPD) markers. Amplification profile generated with all the 19 primers produced 3–16 numbers of bands of 1.5–5 kb size. High level of polymorphism (95.2%) suggested wide range of variability. Maximum Jaccard's similarity coefficient (80%) was observed between KB2MsB and KB2MsC followed by KB5MsC and KB5MsE with 75% similarity, whereas it was minimum between KB3MsA and Kb4MsB (47%). The dendrogram derived from the fingerprint analysis with 19 RAPD primers by using UPGMA showed different levels of genetic similarity among monosporidial lines. At 35% genetic similarity, the monosporidial lines were grouped in two clusters. Some primers, viz., OPN-1, OPN-6, OPN-9, OPN-12, OPN-13, OPN-18, OPM-2, OPM-8, OPM-10, OPB-8, OPB-17 and OPB-20 showed 100% polymorphism. The RAPD fingerprint generated by OPN-1 and OPM-3 were analysed and showed high range of variation in genetic make-up of monosporidial lines.     

Genetic differentiation of charcoal rot pathogen, Macrophomina phaseolina, into specific groups using URP-PCR

Forty isolates of Macrophomina phaseolina, a pathogen causing charcoal dry root rot of soybean, cotton, and chickpea, were genetically characterized with universal rice primers (URP; primers derived from DNA repeat sequences in the rice genome) using polymerase chain reaction (URP-PCR). Out of 12 URPs used in this study, 5 primers were effective in producing polymorphic fingerprint patterns from the DNA of M. phaseolina isolates. Three primers (URP-2F, URP-6R, and URP-30F) were quite informative and produced high levels of polymorphism among the isolates of M. phaseolina. Analysis of the entire fingerprint profiles using unweighted pair-group method with arithmetic averages (UPGMA) clearly differentiated M. phaseolina isolates obtained from soybean, cotton, and chickpea hosts into specific groups. In this study, we found for the first time transferability and use of PCR primers derived from plant genomes to generate host-specific fingerprint profiles of M. phaseolina, a broad host range plant pathogenic fungus. These results demonstrate that URPs are sensitive and technically simple to use for assaying genetic variability in M. phaseolina populations.     

Identification,characterization, validation and cross-species amplification of genic-SSRs in Indian Mustard (<Emphasis Type="Italic">Brassica juncea</Emphasis>)

Brassica juncea is an economically important oilseed crop worldwide. It has limited genomic resources at present. We generated 47,962,057 expressed sequence reads which were assembled into 45,280 unigenes. A total of 4108 SSR loci (≥10 bp) were identified in these unigenes. Trinucleotide was the most frequent repeat unit (59.91 %) followed by di- (38.66 %), tetra - (0.71 %), hexa - (0.49 %) and pentanucleotide repeats (0.24 %). Primers were designed for 2863 SSR loci among which 460 were selected for primer synthesis. A total of 339 loci amplified successfully of which 134 (39.5 %) exhibited polymorphism among six B. juncea genotypes with PIC values ranging from 0.18 to 0.81. Further, 25 polymorphic SSRs were used for analysis of genetic variability in 25 genotypes of Brassicas and their wild relatives. Two to five alleles with PIC values 0.22–0.66 were detected at these loci. The dendrogram grouped the genotypes according to their known pedigree/systematic position.     

Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis

Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92 %, 34/37) and penicillin (89 %, 33/37) followed by resistance towards ampicillin (68 %, 25/37), cefuroxime (38 %, 14/37), amikacin (6 %, 2/37) and ceftazidime (14 %, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80 %. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.     

Molecular identification of isolates of <Emphasis Type="Italic">Peronosclerospora sorghi</Emphasis> from maize using PCR-based SCAR marker

The fungus Peronosclerospora sorghi [Weston and Uppal (Shaw)] infects both sorghum and maize and incites downy mildew disease. Pathogenic and molecular variability among isolates of P. sorghi from sorghum and maize has been reported. In the present study we developed a DNA sequence characterized amplified region (SCAR) marker for identification of isolates of P. sorghi from maize by using polymerase chain reaction (PCR). The random amplified polymorphic DNA (RAPD) primer OPB15 consistently amplified a 1,000 base pairs (bp) product in PCR only from DNA of P. sorghi isolates from maize and not from isolates of sorghum. The PCR-amplified 1,000-bp product was cloned and sequenced. The sequence of the SCAR marker was used for designing specific primers for identification of maize isolates of P. sorghi. The SCAR primers amplified a 800 bp fragment only from genomic DNA of maize isolates of P. sorghi. The SCAR primers developed in this study are highly specific and reproducible, and proved to be powerful tool for identification of P. sorghi isolates from maize.     

A gene cluster for the synthesis of serotype g-specific polysaccharide antigen in Aggregatibacter actinomycetemcomitans

Aggregatibacter actinomycetemcomitans is an important pathogen related to aggressively progressive periodontal breakdown in adolescents and adults. The species can be divided into six serotypes (a–f) according to their surface carbohydrate antigens. Recently, a new serotype g of A. actinomycetemcomitans was proposed. The aim of the present study was to sequence the gene cluster associated with the biosynthesis of the serotype g-specific polysaccharide antigen and develop serotype-specific primers for PCR assay to identify serotype g strains of A. actinomycetemcomitans. The serotype-specific polysaccharide (SSPS) gene cluster of the NUM-Aa 4039 strain contained 21 genes in 21,842-bp nucleotides. The similarity of the SSPS gene cluster sequence was 96.7 % compared with that of the serotype e strain. Seventeen serotype g genes showed more than 90 % homology both in nucleotide and amino acids to the serotype e strain. Three additional genes with 1,579 bp in NUM-Aa 4039 were inserted into the corresponding ORF13 of the serotype e strain. The serotype g-specific primers were designed from the insertion region of NUM-Aa 4039. Serotypes of the a–f strains were not amplified by serotype-specific g primers; only NUM-Aa 4039 showed an amplicon band. The NUM-Aa 4039 strain was three genes in the SSPS gene cluster different from those of serotype e strain. The specific primers derived from these different regions are useful for identification and distribution of serotype g strain among A. actinomycetemcomitans from clinical samples.     

Molecular detection and genotyping of Fusarium oxysporum f. sp. psidii isolates from different agro-ecological regions of India

Twenty one isolates of Fusarium oxysporum f. sp. psidii (Fop), causing a vascular wilt in guava (Psidium guajava L.), were collected from different agro-ecological regions of India. The pathogenicity test was performed in guava seedlings, where the Fop isolates were found to be highly pathogenic. All 21 isolates were confirmed as F. oxysporum f. sp. psidii by a newly developed, species-specific primer against the conserved regions of 28S rDNA and the intergenic spacer region. RAPD and PCR-RFLP were used for genotyping the isolates to determine their genetic relationships. Fifteen RAPD primers were tested, of which five primers produced prominent, polymorphic, and reproducible bands. RAPD yielded an average of 6.5 polymorphic bands per primer, with the amplified DNA fragments ranging from 200–2,000 bp in size. A dendrogram constructed from these data indicated a 22–74% level of homology. In RFLP analysis, two major bands (350 and 220 bp) were commonly present in all isolates of F. oxysporum. These findings provide new insight for rapid, specific, and sensitive disease diagnosis. However, genotyping could be useful in strain-level discrimination of isolates from different agro-ecological regions of India.     

Morphological, Biochemical and Molecular Characterization of Trichoderma harzianum Isolates for their Efficacy as Biocontrol Agents

The random amplified polymorphic DNA (RAPD) procedure was used to examine the genetic variability among 8 isolates of Trichoderma harzianum , and their ability to antagonize Sclerotium rolfsii using a dual culture assay was correlated with RAPD profiles. Eight oligodeoxynucleotide primers were selected for the RAPD assays, which resulted in 86 bands for 8 isolates of T . harzianum . The data were entered into a binary matrix and a similarity matrix was constructed using the DICE similarity (SD) index. An unweighted pair grouping mathematical averaging (UPGMA) cluster based on SD values was generated using the NTSYS computer program. A mean coefficient of similarity obtained for pairwise comparisons was c. 30% and it showed that the variability among the isolates of T. harzianum was very high. Using the dual culture method in antagonism experiments, the T. harzianum isolates were classified in to antagonism classes. Further, T. harzianum isolates were screened for chitinase and β-1,3-glucanase activity. RAPD was efficient in demonstrating the high intraspecific genetic variation among isolates. The dendrogram did not show the grouping of isolates by their level of antagonism. Relationship among polymorphism existent, the aggressiveness and the origin of isolates were not found.     

Polymorphism in the internal transcribed spacer (ITS) region of the ribosomal DNA among different Fusarium species

Fusarium species causing wilt diseases in different plants were characterised by comparing nonpathogenic and different pathogenic species using rDNA RFLP analysis. The ITS (internal transcribed spacer) region of 12 isolates belonging to the section Elegans, Laseola, Mortiella, Discolor, Gibbosum, Lateritium and Sporotrichiella were amplified by universal ITS primers (ITS-1 and ITS-4) using polymerase chain reaction (PCR). Amplified products, which ranged from 522 to 565 bp were obtained from all 12 Fusarium isolates. The amplified products were digested with seven restriction enzymes, and restriction fragment length polymorphism (RFLP) patterns were analysed. A dendrogram derived from PCR-RFLP analysis of the rDNA region divided the Fusarium isolates into three major groups. Assessment of molecular variability based on rDNA RFLP clearly indicated that Fusarium species are heterogeneous and most of the forma speciales have close evolutionary relationships.