The nucleotide sequences of 5S rRNAs from a multicellular green alga, Ulva pertusa, and two brown algae, Eisenia bicyclis and Sargassum fulvellum

The nucleotide sequences of 5S rRNA from a multicellular green alga Ulva pertusa, and multicellular brown algae Eisenia bicyclis and Sargassum fulvellum, have been determined. The 5S rRNA from Ulva is composed of 120 nucleotides, and those from Eisenia and Sargassum have 118 nucleotides. The nucleotide sequence of Ulva 5S rRNA is rather similar to 5S rRNAs from unicellular green algae and higher plants, while those of Eisenia and Sargassum 5S rRNAs are unique.     

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).     

Higher plant origins and the phylogeny of green algae

Summary 5S rRNA sequences from six additional green algae lend strong molecular support for the major outlines of higher plant and green algae phylogeny that have been proposed under varying naming conventions by several authors. In particular, the molecular evidence now available unequivocally supports the existence of at least two well-separated divisions of the Chlorobionta: the Chlorophyta and the Streptophyta (i.e., charophytes) (according to the nomenclature of Bremer). The chlamydomonad 5S rRNAs are, however, sufficiently distinct from both clusters that it may ultimately prove preferable to establish a third taxon for them. In support of these conclusions 5S rRNA sequence data now exist for members of four diverse classes of chlorophytes. These sequences all exhibit considerably more phylogenetic affinity to one another than any of them show toward members of the other cluster, the Streptophyta, or the twoChlamydomonas strains. Among the Charophyceae, new 5S rRNA sequences are provided herein for three genera,Spirogyra, Klebsormidium, andColeochate. All of these sequences and the previously publishedNitella sequence show greater resemblance among themselves and to the higher plants than they do to any of the other green algae examined to date. These results demonstrate that an appropriately named taxon that includes these green algae and the higher plants is strongly justified. The 5S rRNA data lack the resolution needed, however, to unequivocally determine which of several subdivisions of the charophytes is the sister group of the land plants. The evolutionary diversity ofChlamydomonas relative to the other green algae was recognized in earlier 5S rRNA studies but was unanticipated by ultrastructural work. These new data provide further evidence for the relative uniqueness of the chlamydomonads and are discussed further.     

The evolutionary position of the rhodophytePorphyra umbilicalis and the basidiomyceteLeucosporidium scottii among other eukaryotes as deduced from complete sequences of small ribosomal subunit RNA

Summary The complete small ribosomal subunit RNA (srRNA) sequence was determined for the red algaPorphyra umbilicalis and the basidiomyceteLeucosporidium scottii, representing two taxa for which no srRNA sequences were hitherto known. These sequences were aligned with other published complete srRNA sequences of 58 eukaryotes. Evolutionary trees were reconstructed by a matrix optimization method from a dissimilarity matrix based on sections of the alignment that correspond to structurally conservative areas of the molecule that can be aligned unambiguously. The overall topology of the eukaryotic tree thus constructed is as follows: first there is a succession of early diverging branches, leading to a diplomonad, a microsporidian, a euglenoid plus kinetoplastids, an amoeba, and slime molds. Later, a nearly simultaneous radiation seems to occur into a number of taxa comprising the metazoa, the red alga, the sporozoa, the higher fungi, the ciliates, the green plants, plus some other less numerous groups. Because the red alga diverges late in the evolutionary tree, it does not seem to represent a very primitive organism as proposed on the basis of morphological and 5S rRNA sequence data. Asco- and basidiomycetes do not share a common ancestor in our tree as is generally accepted on the basis of conventional criteria. In contrast, when all alignment positions, rather than the more conservative ones, are used to construct the evolutionary tree, higher fungi do form a monophyletic cluster. The hypothesis that higher fungi and red algae might have shared a common origin has been put forward. Although the red alga and fungi seem to diverge at nearly the same time, no such relationship can be detected. The newly determined sequences can be fitted into a secondary structure model for srRNA, which is now relatively well established with the exception of uncertainties in a number of eukaryote-specific expansion areas. A specific structural model featuring a pseudoknot is proposed for one of these areas.     

Variant forms of a group I intron in nuclear small-subunit rRNA genes of the marine red alga Porphyra spiralis var. amplifolia

A group IC1 intron occurs in nuclear small-subunit (18S) ribosomal RNA (SSU rRNA) genes of the marine red alga Porphyra spiralis var. amplifolia. This intron occurs at the same position as the self- splicing group IC1 introns in nuclear SSU rDNAs of the fungus Pneumocystis carinii and in the green alga Chlorella ellipsoidea and shares sequence identity with the Pneumocystis carinii intron in domains L1, P1, P2, and L2, outside the conserved core. Three size variants, differing in amount of sequence in L1, exist and are differentially distributed in geographically distinct populations. Preliminary data suggest that the largest variant can self-splice in vitro. Short open reading frames are present but do not correspond to known genes. Repeated nucleotide motifs, reminiscent of duplicated target sites of transposons or Alu elements, are associated with the intron and with one of the variant forms of L1. Insertions are present in nuclear SSU rDNAs of several other Porphyra species and of the red alga Bangia atropurpurea; insertionless rDNA variants also occur in several Porphyra species. Our observations are most readily explained by intron mobility, although it remains unclear how transfer could have been mediated between genomes of organisms as ecologically diverse as marine red algae, freshwater green algae, and a mammalian-pathogenic fungus.      

Evolutionary change in 5S rRNA secondary structure and a phylogenic tree of 352 5S rRNA species

The secondary structure models of 5S rRNA have been constructed from the primary structure of 352 5S rRNA species available at present. All the 5S rRNAs examined can take essentially the same secondary structure, however they reveal characteristic differences between eukaryotes, metabacteria (= archaebacteria) and eubacteria. These three types of models can be further subgrouped by minor but characteristic differences. A phylogenic tree of organisms has been constructed using these 5S rRNA sequences by the weighted pairing method (WPG method). The tree reveals that there exist several major groups of eubacteria which seem to have diverged into different directions in the early stages of bacterial evolution. After emergence of eubacteria, metabacteria and eukaryotes separated from each other from their common ancestor. In the eukaryotic evolution, red algae (Rhodophyta) emerged first, and thereafter, thraustocytrids-Proctista, Ascomycota, green plants (green algae and land plants), Basidiomycota, Chromophyta (brown algae, diatoms and golden-yellow algae), slime- and water molds, various protozoans, and animals emerged in this order.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics

More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.     

The red algal-higher fungi phylogenetic link: the last ten years

The review of the red algal theory for ancestry of Ascomycetes and Basidiomycetes published 10 years ago by the author is updated. Criticisms are answered and new data are discussed. The production of choline sulfate, lenthionine and lanosol are added to the biochemical similarities between red algae and higher fungi. Distribution of polyols is shown to be in favour of the origin of higher fungi from parasitic red algae. As predicted, NADP-linked glutamate dehydrogenase has been found in red algae, and additional reports of chitin in various algae have been published. New supporting data come from the ultrastructure of red algae: mitosis outside the Ceramiales and ultrastructure of vegetative cells and tetrasporocysts of Corallinaceae. On the other hand, the discovery of proplastids in Holmsella makes it less fungus-like. However, no decisive argument has yet been produced for or against the theory. Further light should be expected from protein and nucleic acid sequences. Promising partial sequences of cytochrome c have indeed been published for red algae but the published 5 S ribosomal RNA sequences have not proven relevant to the problem. Sequences of the slower-evolving large rRNA and cytochrome c of red algae could provide convincing evidence and are urgently needed.     

Comparative study on the evolution of chloroplast ribosomal 5S RNA of a living fossil plant, Cycas revoluta Thumb

The complete nucleotide sequence of Cycas revoluta Thunb chloroplast 5 S rRNA was determined. It consists of 122 nucleotides. This is the only known 5 S rRNA sequence in Gymnospermae. It is highly homologous with chloroplast 5 S rRNA of higher plants (92-97%), but less homologous (about 54%) with those of lower plants. There is however 67% homology between Cycas and a procaryote a. nidulans. The chloroplast 5 S rRNAs of Angiospermae are nearly identical with each other (95-97%). S. oligorhize and L. minor have 100% homology among themselves. We have constructed a phylogenic tree of 5 S rRNA sequences from fifteen plant chloroplasts. The result suggests that the emergence of algae occurred at an early stage of plant chloroplast evolution and that green plants originated from green algae. This is in agreement with the classical view and other theories of molecular evolution. However there is no common ancestor in the case of Bryophyta and ferns. Among the Angiospermae, a precise evolutionary process cannot be deduced because the Knuc values among the species are very close to each other.     

Complete sequence of the mitochondrial DNA of the red alga Porphyra purpurea. Cyanobacterial introns and shared ancestry of red and green algae.

The mitochondrial DNA (mtDNA) of Porphyra purpurea, a circular-mapping genome of 36,753 bp, has been completely sequenced. A total of 57 densely packed genes has been identified, including the basic set typically found in animals and fungi, as well as seven genes characteristic of protist and plant mtDNAs and specifying ribosomal proteins and subunits of succinate:ubiquinone oxidoreductase. The mitochondrial large subunit rRNA gene contains two group II introns that are extraordinarily similar to those found in the cyanobacterium Calothrix sp, suggesting a recent lateral intron transfer between a bacterial and a mitochondrial genome. Notable features of P. purpurea mtDNA include the presence of two 291-bp inverted repeats that likely mediate homologous recombination, resulting in genome rearrangement, and of numerous sequence polymorphisms in the coding and intergenic regions. Comparative analysis of red algal mitochondrial genomes from five different, evolutionarily distant orders reveals that rhodophyte mtDNAs are unusually uniform in size and gene order. Finally, phylogenetic analyses provide strong evidence that red algae share a common ancestry with green algae and plants.     

Analysis of a plastid gene cluster reveals a close relationship betweenCyanidioschyzon andCyanidium

Cyanidioschyzon merolae andCyanidium caldarium are representative species among of the most primitive algae, although the two species are distinctly different in various morphological traits. We determined the nucleotide sequence of therbcL gene and a flanking 8-kb region in the plastid genome of each of these algae. In both algae, 12 genes were identified in this region, in an identical order. This gene order is not conserved in the plastid genomes of other species of the kingdom Plantae that have been sequenced to data. An additional unidentified open reading frame was also found in the two algae that we analyzed, which has not been described in any other species of algae includingPorphyra purpurea. Comparison of the amino acid sequences of selected genes also supported the conclusion thatCyanidioschyzon merolae andCyanidium caldarium are closely related and that they are distinct from other rhodophytes. The nucleotide sequence data reported in this paper will appear in the DDBJ, EMBL and GenBank Nucleotide Sequence Databases under the accession numbers D63675 and D63676.     

Interrelationships among major protistan groups based on a parsimony network of 5S rRNA sequences

To test the validity of the maximum parsimony approach to discern protistan interrelationships, we have derived an optimal network of 16S-like rRNA sequences using our parsimony algorithm and compared it with those reported using the distance matrix method. We have also derived an optimal network topology of 50 5S rRNA sequences through an interactive search using our algorithm. In both these networks, the kinetoplastids and euglenoids form a linkage group with Dictyostelium emerging from its neighbourhood. The cryptophytes, dinoflagellates and chromophytes and green algae emerge as independent lines suggesting that plastids arose more than once during protistan evolution. The large 5S rRNA tree further indicates independent origins of mesozoa and metazoa; kinetoplastids and ciliates; and diphyletic origin of fungi. Comparatively close positions of charales and land plants, chytrids and Zygomycetes, Physarum and amoeba, and red algae and green algae are also seen in this network.     

The nucleotide sequences of 5S rRNAs from two ribbon worms: Emplectonema gracile contains two 5S rRNA species differing considerably in their sequences.

The nucleotide sequences of 5S rRNAs from two nemerteans (ribbon worms), Lineus geniculatus and Emplectonema gracile have been determined. Emplectonema has two 5S rRNA species that are composed of 119 and 120 nucleotides, respectively. The sequences of these two 5S rRNAs differ at 22 positions. On the other hand, only a single 5S rRNA species was found in Lineus. The sequence similarity percents are 88% (Lineus/Emplectonema longer 5S rRNA), 82% (Emplectonema longer/Emplectonema shorter) and 80% (Lineus/Emplectonema shorter). The comparisons of these sequences with those of other organisms suggest that the phylum Nemertinea is most related to the Mollusca (91%) and the Rotifera (89%), but not to fresh-water planarias (72%).     

Cladistic analysis of 5S rRNA and 16S rRNA secondary and primary structure—The evolution of eukaryotes and their relation to archaebacteria

Summary The secondary structure of 5S rRNA has been elucidated by a cladistic analysis resulting in minimal models for eukaryotes, eubacteria, and halophilic-methanogenic archaebacteria, as well as for an ur-5S rRNA. This ancestor of all present-day 5S rRNA molecules is compared with an ur-tRNA and can be fitted into a tRNA-like structure allowing tertiary-structure interactions at the equivalent positions. A phylogenetic analysis of eukaryotic 5SrRNA and 16S rRNA sequences confirms particular monophyletic taxa: rhodophytes (red algae), chlorobionts (green algae and plants), metazoans (multicellular animals), euglenozoans (euglenids and trypanosomatids), a group of zygomycetes (excluding Kickxellales), a group of ascomycetes (excluding Protomycetales), two distinct groups of basidiomycetes, and a group consisting of phaeophyceans (brown algae) and oomycetes (water molds). The Euglenozoa show a distinct relation to the Eumycota (true fungi) and Metazoa. An analysis of archaebacterial sequences substantiates the paraphyletic nature of this third urkingdom defining the eubacteria as a sister group of the halophile-methanogens and defining the eukaryotes as a sister group of a particular lineage of the eocytes/sulfur-dependents. The latter fact implies that even the eocytes/sulfur-dependent archaebacteria are paraphyletic.Presented at the FEBS Symposium on Genome Organization and Evolution, held in Crete, Greece, September 1–5, 1986Dedicated to the memory of Erik Huysmans who died on July 8, 1986, at the age of 29.     

Primary structure and sequence organization of the 16S–23S spacer in the ribosomal operon of soybean (Glycine max L.) chloroplast DNA

Summary The nucleotide sequence of a spacer region between 16S and 23S rRNA genes from soybean chloroplasts has been determined. The spacer region is over 3000 bp long and contains two tRNA genes, coding for rRNA^Ile and tRNA^Ala which contain intervening sequences of 953 and 811 base pairs respectively. There is a strong homology between the two introns suggesting that they have a common origin. These spacer tRNAs are synthesized as part of a kb precursor molecule containing 16S and 23S rRNA sequences.     

Microheterogeneity of the primary structure of the short repeated 5S DNA unit in diploid wheat Triticum monococcum L

Nucleotide sequences of two 5S rRNA genes located in repeated 327 bp long units were determined in diploid wheat Triticum monococcum. They were compared with sequences of 5S rRNA genes of Tr. monococcum and Tr. aestivum which were earlier determined. The differences were revealed in two localizations of the nucleotide sequence in 5S DNA coding regions of Tr. monococcum and - in nine localizations in nontranscribed spacer. It was established that the nucleotide sequence of 5S rRNA gene cloned in pTm5S9 plasmid and 5S DNA coding region in Tr. aestivum have significant homology. Diploid wheat Tr. monococcum was supposed to have 5S rRNA genes with different functional activity within one multigene family.