Synthesis of 5-Halogeno-6-amino-2′-deoxyurldines and their Analogs as Potential Inhibitors of Thymidine Phosphorylase

ABSTRACT

5-Halogeno-6-amino-2′-deoxyuridines were synthesized from 2′-deoxyuridine as potential thymidine phosphorylase (ThdPase) inhibitors. Among the compounds synthesized, 5-bromo-6-amino-2′-deoxyuridine (6) and 5-iodo-6-amino-2′-deoxyuridine (9) were found to inhibit ThdPase activity with IC50 values of 1.3 μM and 6.5 μM, respectively. In vitro cell culture studies showed that compound (6) can significantly enhance the cytotoxic effects of 5-fluoro-2′-deoxyuridine against a human colon cancer HCT-8 cell line.     

Synthesis of 2,2′-Anhydro Nucleosides with a Modified Sugar Side-Chain

Abstract

2,2′-Anhydro-1-(5,6-di-O-benzoyl-β-D-altrofuranosyl)thymine 6 and uracil derivative 7 are prepared by transformation of the corresponding 5′,6′-di-O-benzoyl-3′-O-mesyl-β-D-glucofuranosyl nucleosides 4 and 5 into the 2,2′-anhydro derivatives 6 and 7 using DBU.     

Study on Disulfur-Backboned Nucleic Acids: Part 3. Efficient Synthesis of 3′,5′-Dithio-2′-Deoxyuridine and Deoxycytidine

A general method is described for synthesizing 3′,5′-dithio-2′-deoxypyrimidine nucleosides 6 and 13 from normal 2′-deoxynucleosides. 2,3′-Anhydronucleosides 2 and 9 are applied as intermediates in the process to reverse the conformation of 3′-position on sugar rings. The intramolecular rings of 2,3′-anhydrothymidine and uridine are opened by thioacetic acid directly to produce 3′-S-acetyl-3′-thio-2′-deoxynucleosides 3 or 5. To cytidine, OH^? ion exchange resin was used to open the ring and 2′-deoxycytidine 10 was abtained in which 3′-OH group is in threo-conformation. The 3′-OH is activated by MsCl, and then substituted by potassium thioacetate to form the S,S′-diacetyl-3′,5′-dithio-2′-deoxycytidine 12. The acetyl groups in 3′,5′ position are removed rapidly by EtSNa in EtSH solution to afford the target molecules 6 and 13. The differences of synthetic routes between uridine and cytidine are also discusssed.     

Synthesis and Evaluation of Novel 6′,6′-Difluoro 5′-Deoxycarbocyclic Phosphonic Acid Nucleosides as Antiviral Agents

The authors describe highly efficient synthetic routes for the preparation of novel 6′,6′-difluoro 5′-deoxycarbocyclic phosphonic acid nucleosides from 1,4-dihydroxy-2-butene. The discovery that the 6′-fluorinated carbocyclic nucleoside (2, EC₅₀ = 0.16 μM) is a potent anti-HSV-1 agent led to the syntheses and biological evaluations of 6′-modified 5′-deoxyversions of carbocyclic phosphonate nucleosides. The synthesized nucleoside analogues 15, 18, 22, and 25 were tested for anti-HIV activity and for cytotoxicity. However, none of them showed significant anti-HIV-1 activity or cytotoxicity at concentrations up to 100 μM.     

Synthesis of Some 2′,3′-Dideoxy-2′-C-Methyl-Substituted Nucleosides

Abstract

Nucleoside analogues analogues1-(2′,3′-dideoxy-2′-C-hydroxymethyl-β-D-erythro-pentofuranos-yl)thymine (1), 2′,3′-dideoxy-2′-C-hydroxymethylcytidine (2), 2′,3′-dideoxy-2′-C-hydroxymethyladenosine (3), 1-(2′-C-azidomethyl-2′,3′-dideoxy-β-D-erythro-pento-furanosyl)thymine (4), 2′-C-azidomethyl-2′,3′-dideoxycytidine (5), and 2′3′-dideoxy-2′-C-methylcytidine (6) have been synthesized from (S)-4-hydroxymethyl-y-butyro-lactone (7)     

SYNTHESIS of 2′-DEOXY-2′-FLUOROGUANYL-(3′,5′)-GUANOSINE

ABSTRACT

The protected analogue of 2-amnio-6-chloropurine arabinoside (3b) was subjected to reaction with diethylaminosulfur trifluoride (DAST) and subsequently treated with NaOAc in Ac₂O/AcOH to give N ²,O ^3′,O ^5′-triacetyl-2′-deoxy-2′-fluoroguanosine (5a). After deacetylation of the sugar moiety and protection of 5′-OH by a 4,4′-dimethoxytrityl group, this nucleoside component was converted to 2′-deoxy-2′-fluoroguanyl-(3′,5′)-guanosine (6c, GfpG).     

A Short High Yielding Synthesis of the Potent Anti-VZV Carbocyclic Nucleoside Analogue Carba-BVDU

Abstract

A short high yielding synthesis of the potent anti-varicella-zoster virus (VZV) carbocyclic nucleoside analogue carba-BVDU 1 starting from aminodiol 2 is described. Reaction of 2 with acyl carbamate 3 and subsequent ring closure under acidic conditions afforded 5-ethyl-2′-deoxy-4′a-carbauridine 5. In situ acetylation of 5 afforded 3′,5′-di-O-acetyl-5-ethyl-2′-deoxy-4′a-carbauridine 6 in 78% overall yield from 2. Radical bromination of 6 with either bromine or NBS and subsequent treatment with triethylamine gave an efficient conversion to 3′,5′-di-O-acetyl-5-(E)-(2-bromovinyl)-2′-deoxy-4′a-carbauridine 7. Deacetylation of 7 afforded 1 in an overall 45–53% yield from 2.     

Synthesis,characterization and biological evaluation of novel 4′-fluoro-2′-hydroxy-chalcone derivatives as antioxidant,anti-inflammatory and analgesic agents

Abstract

In an effort to develop safe and potent anti-inflammatory agents, a series of novel 4′-fluoro-2′-hydroxychalcones 5a–d and their dihydropyrazole derivatives 6a–d was prepared. It was synthesized via aldol condensation of 4′-fluoro-2′-hydroxyacetophenone with appropriately substituted aldehydes followed by cyclization with hydrazine hydrate. All the synthesized compounds were evaluated for their antioxidant, anti-inflammatory, cyclooxygenase inhibition selectivity and analgesic activities. The dimethoxychalcone 5a and its dihydropyrazole derivative 6a showed the highest antioxidant activity, while the monomethoxychalcone 5d and its dihydropyrazole derivative 6d showed the highest analgesic and anti-inflammatory activities. It was also found that there is a close correlation between 4′-fluoro-2′-hydroxychalcones 5a–d and their dihydropyrazole derivatives 6a–d in the screened biological activities. To explain the correlation between the synthesized chalcones and their dihydropyrazole derivatives, especially for the anti-inflammatory activity, docking studies were performed.     

Synthesis and Physiological Activity of Methyl 6′6′-Didemethyl Abscisate and New Chiral Analogs

Methyl 6′, 6′-didemethyl abscisate (5) was synthesized and assayed to elucidate the physiological activity of methyl substituents on the cyclohexene ring of abscisic acid (ABA). During this study two new chiral stereoisomeric analogs 6 and 7 were synthesized from l-and d-carvone. The rice seedling assay and germination assay of garden radish showed that 6′-methyl groups of ABA were not important in biological activity and that 5′-isopropenyl analogs 6 and 7 were inactive.     

Conformationally Locked Nucleosides. Synthesis of Oligodeoxynucleotides Containing 3′-Amino-3′-deoxy-3′-N,5′(R)-C-ethylenethymidine

Abstract

3′-Amino-3′-deoxy-5′-O-(4,4′-dimethoxytrityl)-3′-N,5′(R)-C-ethylenethymidine (6) was synthesized starting from 3′-azido-3′-deoxythymidine. Condensation of 6 with 5′-O-(H-phosphonyl)thymidine and 5′-O-(p-nitrophenoxycarbonyl)thymidine derivatives gave dinucleotide and dinucleoside derivatives, respectively, which were incorporated into oligodeoxynucleotides (ODNs). Tm data of the modified ODNs are also presented.     

Steric Effect of a Bulky Substituent At 5′-Position on the Regioselectivity of 2′ vs. 3′-O-Methylation of N6- Cyclohexyladenosine

Abstract

Steric effect of a trityl or substituted trityl group at 5′-OH of N⁶-cyclohexyladenosine on the regioselective 2′ vs. 3′-O-methylation under phase transfer catalysis conditions was investigated. Compound 4 showed only a modest increase in the selectivity of 2′ over 3′-O-methylation compared to compound 1.     

Two new anti-plasmodial flavonoid glycosides from Duranta repens

The CHCl₃-soluble fraction of the whole plant of Duranta repens showed anti-plasmodial activity against the chloroquine-sensitive (D6) and chloroquine-resistant (W2) strains of Plasmodium falciparum, with IC₅₀ values of 8.5?±?0.9 and 10.2?±?1.5?μg/mL, respectively. From this fraction, two new flavonoid glycosides, 7-O-α-d-glucopyranosyl-3,4′-dihydroxy-3′-(4-hydroxy-3-methylbutyl)-5,6-dimethoxyflavone (1) and 7-O-α-d-glucopyranosyl(6′′′-p-hydroxcinnamoyl)-3,4′-dihydroxy-3′-(4-hydroxy-3-methylbutyl)-5,6-dimethoxyflavone (2), along with five known flavonoids, 3,7,4′-trihydroxy-3′-(4-hydroxy-3-methylbutyl)-5,6-dimethoxyflavone (3), 3,7-dihydroxy-3′-(4-hydroxy-3-methylbutyl)-5,6,4′-trimethoxyflavone (4), 5,7-dihydroxy-3′-(2-hydroxy-3-methyl-3-butenyl)-3,6,4′-trimethoxyflavone (5), 3,7-dihydroxy-3′-(2-hydroxy-3-methyl-3-buten-yl)-5,6,4′-trimethoxyflavone (6), and 7-O-α-d-glucopyranosyl-3,5-dihydroxy-3′-(4′′-acetoxy-3′′-methylbutyl)-6,4′-dimethoxyflavone (7), have been isolated as anti-plasmodial principles. Their structures were deduced by spectroscopic analysis including 1D and 2D NMR techniques. The compounds (1–7) showed potent anti-plasmodial activities against D6 and W2 strains of Plasmodium falciparum, with IC₅₀ values in the range of 5.2–13.5?μM and 5.9–13.1?μM, respectively.     

Interaction of (2′ -5′) and (3′ -5′) Linked 2-Aminoadenylyl-3-aminoadenosines with Polyuridylic Acid

Abstract

2′-5′ and 3′-5′ linked 2-aminoadenylyl-2-aminoadenosines [(2′-5′)n²Apn²A (1) and (3′-5′)n²Apn²A (2)] were synthesized by condensation of 5′-O-monomethoxytrityl-N ² N ⁶-dibenzoyl-2-aminoadenosine and N ²,N ⁶,2′,3′-O-tetrabenzoyl-2-aminoadenosine 5′-phosphate using dicyclohexylcarbodiimide (DCC). The conformational properties of these dimers 1 and 2 were examined by UV, NMR and CD spectroscopy. The results reveal that the 2′-5′-isomer 1 takes a stacked conformation, which contains a larger base-base overlap and is more stable against thermal perturbation with respect to the 3′-5′-isomer 2. Interactions of 1 and 2 with polyuridylic acid (Poly (U)) were also examined by Tm, mixing curves, UV and CD spectra. Both the dinucleoside isomers 1 and 2 formed a complex of 1 : 2 stoichiometry with poly(U), which was much more stable than that of the corresponding ApA isomer     

Synthesis and Anti-Hiv Activity of 3′-0-Formyl Derivatives of Thymidine and 2′-Deoxyuridine

Abstract

Reaction of the 5′-O-t-butyldimethylsilyl derivatives of thymidine and 2′-deoxyuridine with the Vilsmeier reagent (POCI₃/DMF), and removal of the t–butyldimethylsilyl protecting group, afforded 3′-O-formylthymidine (5) and 3′-O-formyl-2′-deoxyuridine (6), respectively. In vitro evaluation, determined as the ability of the test compound to inhibit HIV induced cytopathogenicity in CEM cells, indicated that 5 was moderately active, whereas 6 was inactive.     

Synthesis of 3′-Deoxy-3′-[4-(pyrimidin-1-yl)methyl-1,2,3-triazol-1-yl]thymidine via 1,3-Dipolar Cycloaddition

Abstract

The synthesis of new 3′-deoxy-3′-[4-(pyrimidin-1-yl)methyl-1,2,3-triazol-1-yl]thymidine 6a–f, from 3′-azido-3′-deoxy-5′-O-monomethoxytrityl-thymidine is described. The key step is the 1,3-dipolar cycloaddition between the azido group of the protected AZT 3 and N-1-propargylpyrimidine derivatives 2a–f. All new derivatives 6a–f were evaluated for their inhibitory effects against the replication of HIV-1 (IIIB), HIV-2 (ROD). No marked activity was found.     

Syntheses,Crystal Structures,and Hydrogen Bonding Patterns of 3′-C-Methylenecarboxylic-3′-deoxythymidine and 3′-C-Methyleneamidilylic-3′-deoxythymidine

Abstract

Thymidine derivatives containing carboxylic acid and amide groups have been synthesized and the hydrogen-bonding patterns of 3′-C-methylenecarboxylic-3′-deoxythymidine 6 and 3′-C-methyleneamidilylic-3′-deoxythymidine 9 have been characterized by using X-ray crystallography.     

Reaction of the 2′-Silyl and 2′-Stannyl Derivatives of 6-(Bromomethyl)Dimethylsilyl-1′,2′-Unsaturated Uridine Under Radical Conditions

The mode of cyclization (5-exo versus 6-endo) of 2-sila-5-hexen-1-yl radicals generated from 2′-tributylstannyl- and 2′-trimethylsilyl-6-(bromomethyl)dimethylsilyl-1′,2′-unsaturated uridines (8 and 9) was investigated. Although the actual structure of the reaction products differ from each other, reflecting the ease of elimination of the 2′-substituent, it was found that both substrates prefer the 5-exo-cyclization pathway.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

SYNTHESIS OF 3′-THIOAMIDO-MODIFIED 3′-DEOXYTHYMIDINE-5′-TRIPHOSPHATES AND THEIR USE AS CHAIN TERMINATORS IN SANGER-DNA SEQUENCING

The thioamide derivatives 3′-deoxy-5′-O-(4,4′-dimethoxytrityl)-3′-[(2-methyl-1-thioxo-propyl)amino]thymidine 1 and 3′-deoxy-5′-O-(4,4′-dimethoxytrityl)-3′-{{6-{[(9H-(fluo-ren-9-ylmethoxy)carbonyl]-amino}-1-thioxohexyl}amino} thymidine 2 were synthesized by regioselective thionation of their corresponding amides 7 and 8 with 2,4-bis(4-methoxyphenyl)-1,3,2,4-dithiadiphosphet-ane-2,4-disulfide (Lawesson's reagent). The thioamides were converted into the corresponding 5′-triphosphates 3 and 4. Compound 3 was chosen for DNA sequencing experiments and 4 was further labelled with fluorescein.     

Studies Towards Synthesis of Dinucleoside Arylphosphonates with Metal Complexing Properties

Abstract

An efficient and stereospecific synthesis of dinucleoside 4′-(2,2′:6′,2″-terpyridyl)phosphonate 2 and 5-(2,2′-bipyridyl)phosphonate 3 via a palladium(0) cross coupling strategy has been developed.