Nucleoside H-Phosphonates. IX. Possible Side-Reactions During Hydrogen Phosphonate Diester Formation

Abstract

Possible side-reactions during hydrogenphosphonate diester formation in the presence of various condensing reagents (e.g. arensulfonyl derivatives, chlorophosphates and acyl chlorides) have been investigated using ³¹P NMR spectroscopy.     

Synthesis of Dinucleoside Boranophosphates by a Boranophosphotriester Approach

Abstract

Dinucleoside boranophosphates including four kinds of nucleobases were synthesized by a boranophosphotriester method in good yields. In the present boranophosphotriester method, side-reactions at the nucleobases, which caused by a borane reagent, were completely avoided.     

Modification of H-phosphonate method of oligonucleotide synthesis on polymer support

The mechanism of the internucleotide condensation and side-reactions in H-phosphonate approach has been investigated with the help of NMR-spectroscopy. On the basis of the results obtained a modification minimizing side-reactions in the course of the nucleotide component preactivation has been developed. It includes the use of acetonitrile--quinoline (4:1) mixture as the solvent in coupling reactions. The efficiency of the method is illustrated by the synthesis of oligodeoxynucleotides.     

Synthesis,characterization and DNA binding and cleavage properties of ruthenium(II) complexes with various polypyridyls

Polypyridyl chlororuthenium(II) complexes have been synthesized and characterized. The binding mode of the complexes to DNA has been evaluated from the combined results of electronic absorption spectroscopy and viscosity measurement study. The results suggest that complexes 1, 2 and 3 bind to DNA via classical intercalation, electrostatic interaction and partial intercalation mode, respectively. Complex 2 shows less affinity for DNA. Cleavage of pUC19 DNA by complexes has been checked using gel electrophoresis. The data disclose that complex 1 has the highest cleaving ability.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

A New Flavanone with Antifungal Activity Isolated from Hops

6-Isopentenylnaringenin 1, which has previously been synthesized by other workers, was isolated together with xanthohumol 2 and isoxanthohumol 3 from hard resins of hops ( Humulus lupulus L.). The structures of 1 and sophoraflavanone B were examined; that of the latter previously reported as 6-isopentenylnaringenin, has been revised to 8-isopentenylnaringenin. 1, 2 and 3 were found to have antifungal activities.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Definitive Solution Structures for the 6-Formylated Versions of 1-(βD-Ribofuranosyl)-, 1-(2′-Deoxy-β-D-Ribofuranosyl)-, and 1-β-D-Arabinofuranosyluracil,and of Thymidine

Abstract

ROESY and NOESY NMR spectroscopic analyses of the ribofuranosyl (1a), 2′-deoxyribofuranosyl (1b), and arabinofuranosyl (1c) derivatives of 6-formyluracil in (CD₃)₂SO and D₂O solutions have established that each exclusive 7,05′-cyclic hemiacetal diastereomer of 1a,b and the major 7,O2′-cyclic hemiacetal diastereomer of 1c possess the 7R configuration. In addition, (7R)-1c has been shown to be thermodynamically more stable than (7S)-1c, contrary to our previous indication. A new, higher yielding synthetic route to 1a has been developed, 1b has been obtained for the first time in crystalline form, the route to 1c has been modified to better accommodate large scale preparations, and a new, fourth member of this class, 6-formylthymidine (1d), has been synthesized and its solution structures in (CD₃)₂SO, D₂O, and CD₃OD have been determined. Antitumor and antiviral evaluations of 1a-c have revealed no significant levels of activity.     

3′-C-Hydroxymethylthymidine: Synthesis and Incorporation into Oligodeoxynucleotide Analogues

Abstract

The stereoselective synthesis of 3′-C-hydroxymethylthymidine (5) in five steps from thymidine has been accomplished and this nucleoside has been incorporated into oligodeoxynucleotides (ODNs) in different ways.     

Enhanced in vitro translation at reduced temperatures using a cold-shock RNA motif

Cell-free synthesis of recombinant proteins has emerged as an alternative method of protein production although protein yields still cannot compete with in vivo expression techniques. In systems based on S30 extracts of Escherichia coli unfavorable side-reactions are involved in limiting protein yields. Therefore, carrying out cell-free reactions at lower temperatures might be beneficial as side reactions should be decreased. In this study we show that by using the 5′-untranslated region of the cold-shock gene cspA from E. coli as mRNA leader in cell-free reactions, the expression temperature can be decreased and simultaneously leads to an increase in protein yields. A compensation for the lower activity of T7 RNA polymerase at lower temperatures enhances protein synthesis even further. Additionally, this 5′-untranslated region also standardizes the optimal expression temperature of different proteins.     

Carbocyclic Nucleosides with a Modified Cyclopentane Skeleton

Abstract

The aminoalcohol 4 has been converted into carbocyclic nucleoside analogues 2 and 3.     

Spectral analysis and in vitro cytotoxicity profiles of novel organotin(IV) esters of 2-maleimidopropanoic acid

Six novel triorganotin(IV) 2-maleimidopropanoato complexes: R₃SnOCOCH₃(CH)(COCH)₂, (R: Me(1), Et(2), n-Pr(3), n-Bu(4), Ph(5), Bz(6) have been synthesized. Their solid-state configuration has been determined by FT IR and ^119mSn Mössbauer spectroscopy. The tin(IV) atom is five-coordinated in all the complexes with 2-maleimidopropanoic acid behaving as a monoanionic bidentate ligand coordinating the tin(IV) atom through a chelating or bridging carboxylate group. The solution-state configuration has been elucidated by means of ¹H-, ¹³C- and ¹¹⁹Sn-NMR spectroscopy which assigned a tetrahedron. Elemental analysis and FAB MS data also supported a 1:1 metal to ligand stoichiometry. The title complexes have been screened in vitro for anti-tumour, anti-fungal, anti-leishmanial and urease inhibition activities and displayed promising results.     

Synthesis in Nucleoside Antibiotics

Both ribofuranoside (3) and ribopyranoside (5) of 4-amino-5-cyano-6-methy lmercaptopyr-rolo[2,3-d]pyrimidine (analogs of toyocamycin) have been synthesized for the first time by the fusion procedure using bis-(p-nitrophenyl) hydrogen phosphate as catalyst. Evidence for the β-configuration has been provided by analyzing the NMR spectra and ORD curves. The tumor-inhibitory activity of 3 against EhrIich ascites carcinoma in mice has also been examined.     

Interrogation of a Sonogashira Cross-Coupling of 8-Bromoguanosine with Phenylacetylene on Amberlite: Evidence for Pd/Cu Ion Binding and Propagation of Pd/Cu Nanoparticles

The reactivity of Amberlite (IRA-67) base “heterogeneous” resin in Sonogashira cross-coupling of 8-bromoguanosine 1 with phenylacetylene 3 to give 2 has been examined. Both 1 and 2 coordinate to Pd and Cu ions, which explains why at equivalent catalyst loadings, the homogeneous reaction employing triethylamine base is poor yielding. X-ray photo-electron spectroscopy (XPS) has been used to probe and quantify the active nitrogen base sites of the Amberlite resin, and postreaction Pd and Cu species. The PdCl₂(PPh₃)₂ precatalyst and CuI cocatalyst degrade to give Amberlite-supported metal nanoparticles (average size ～2.7 nm). The guanosine product 2 formed using the Amberlite Pd/Cu catalyst system is of higher purity than reactions using a homogeneous Pd precatalyst, a prerequisite for use in biological applications.     

Pyrrolylbenzothiazole Derivatives as Aldose Reductase Inhibitors

Abstract

2,2-Dimethyl-4-hydroxy-4-androstene-3,17-dione (4) has been synthesized and has been shown to be a powerful competitive inhibitor of aromatase (K_i = 11.4nM). However, compound 4 does not cause time-dependent loss of enzyme activity, in contrast to the unmethylated parent compound, 4-OHA.     

Hybrid α/β-peptides: For-Met-Leu-Phe-OMe analogues containing geminally disubstituted β2,2- and β3,3-amino acids at the central position

Summary. The two fMLF-OMe analogues For-Met-β³hAc₆c-Phe-OMe (6) and For-Met-β²hAc₆c-Phe-OMe (12) and their corresponding N-Boc derivatives 5 and 11 have been synthesized and their biological activity towards human neutrophils evaluated. The N-formyl peptides 6 and 12 exhibit good activity as chemoattractans and 12 is highly active in superoxide anion production. The preferred solution conformation of the two N-formyl derivatives has been discussed.     

New Coumaronochromones from White Lupin,Lupinus albus L. (Leguminosae)

A further investigation of the isoflavonoid constituents occurring in roots of the white lupin (Lupinus albus L. cv. Kievskij Mutant) has yielded five new coumaronochromones named lupinalbin A (la), B (2a), C (3), D (4) and E (5). These isoflavonoids were identified by physicochemical methods involving the use of biogenetically related 2′-hydroxyisoflavones as reference compounds. The presence of the rare dihydrofurano-isoflavone, erythrinin C (16), in white lupin roots has also been established.     

DNA sequence-specific ligands: XIV. Synthesis of fluorescent biologically active dimeric bisbenzimidazoles DB(3, 4, 5, 7, 11)

Five fluorescent symmetrical dimeric bisbenzimidazoles DB(n) containing four 2,6-substituted benzimidazole cores and differing in the length of the oligomethylene linker between two bisbenzimidazole rings (n = 3, 4, 5, 7, 11) have been synthesized. The ability of the dimeric bisbenzimidazoles to form complexes with the double-stranded DNA has been shown by spectral methods. Upon binding to the double-stranded DNA, DB(n) are localized in the narrow groove. The data on the inhibition of the DNA methyltransferase Dnmt3a by DB(n) indicate that dimeric bisbenzimidazoles DB(3) and DB(11) site-specifically bind to the oligonucleotide duplex.     

The Synthesis of 2′-C-Functionalised Nucleosides for Incorporation into Catalytic RNA

Abstract

Five 2′-C-functionalized nucleosides (1–5) have been prepared and incorporated into dinucleoside monophosphates. The effect of the functionality on the stability of the adjacent phosphodiester bond toward hydrolysis by nuclease enzymes and extremes of pH has been assessed.     

Synthesis and Antiviral Evaluation of Adenosine-N1-Oxide and 1-(Benzyloxy) Adenosines

Abstract

The antiviral activity of adenosine-N¹-oxide (1) and a variety of substituted 1-(benzyloxy) adenosines (2) has been re-investigated and significant in vitro activity vs. Vaccinia virus has been shown. In vivo activity in mice has also been demonstrated.